* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Local functions for FMRP in axon growth cone motility and activity
Endocannabinoid system wikipedia , lookup
Electrophysiology wikipedia , lookup
Environmental enrichment wikipedia , lookup
Metastability in the brain wikipedia , lookup
Neural oscillation wikipedia , lookup
Neuroregeneration wikipedia , lookup
Neuromuscular junction wikipedia , lookup
Single-unit recording wikipedia , lookup
Biological neuron model wikipedia , lookup
Holonomic brain theory wikipedia , lookup
Biochemistry of Alzheimer's disease wikipedia , lookup
Multielectrode array wikipedia , lookup
Neural coding wikipedia , lookup
Mirror neuron wikipedia , lookup
Molecular neuroscience wikipedia , lookup
Caridoid escape reaction wikipedia , lookup
Stimulus (physiology) wikipedia , lookup
Neurotransmitter wikipedia , lookup
Central pattern generator wikipedia , lookup
De novo protein synthesis theory of memory formation wikipedia , lookup
Clinical neurochemistry wikipedia , lookup
Development of the nervous system wikipedia , lookup
Apical dendrite wikipedia , lookup
Circumventricular organs wikipedia , lookup
Premovement neuronal activity wikipedia , lookup
Nonsynaptic plasticity wikipedia , lookup
Neuropsychopharmacology wikipedia , lookup
Feature detection (nervous system) wikipedia , lookup
Neuroanatomy wikipedia , lookup
Nervous system network models wikipedia , lookup
Pre-Bötzinger complex wikipedia , lookup
Optogenetics wikipedia , lookup
Activity-dependent plasticity wikipedia , lookup
Synaptic gating wikipedia , lookup
Axon guidance wikipedia , lookup
Chemical synapse wikipedia , lookup
Dendritic spine wikipedia , lookup
www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 32 (2006) 37 – 48 Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses Laura N. Antar,a Chanxia Li,b Honglai Zhang,a Reed C. Carroll,a and Gary J. Bassell b,* a Department of Neuroscience, Rose F. Kennedy Center for Mental Retardation, Albert Einstein College of Medicine, 1410 Pelham Parkway, Bronx, NY 10461, USA b Departments of Cell Biology and Neurology, Emory University School of Medicine, 615 Michael St., Atlanta, GA 30322, USA Received 27 July 2005; revised 31 January 2006; accepted 14 February 2006 Available online 2 May 2006 Genetic deficiency of the mRNA binding protein FMRP results in the most common inherited form of mental retardation, Fragile X syndrome. We investigated the localization and function of FMRP during development of hippocampal neurons in culture. FMRP was distributed within granules that extended into developing axons and growth cones, detectable at distances over 300 Am from the cell body. In mature cultures, FMRP granules were present in both axons and dendrites, with pockets of higher concentrations appearing intermittently, along distal axon segments and near synapses. MAP1b mRNA, a known FMRP target, was also localized to axon growth cones. Morphometric analysis of growth cones from the FMR1 KO revealed both excess filopodia and reduced motility. At later stages during synapse formation, FMR1 KO neurons exhibited excessive filopodia and long spines along dendrites, yet there was a marked decrease in the density of spine-like protrusions juxtaposed to presynaptic terminals. In contrast, there was no difference in the density of shaft synapses between FMR1 KO and WT. Brief depolarization of WT neurons resulted in increased numbers of filopodia and spine synapses, whereas no additional morphologic changes were observable in dendrites of FMR1 KO neurons that already had increased density of filopodia – spines. These findings suggest that alterations in the regulation of axonal growth and innervation in FMR1 KO neurons may contribute to the dendritic and spine pathology in Fragile X syndrome. This work has broader implications for understanding the role of mRNA binding proteins in developmental and proteinsynthesis-dependent plasticity. D 2006 Elsevier Inc. All rights reserved. Introduction Fragile X syndrome (FXS) is caused by the lack of expression of the Fragile X Mental Retardation Protein (FMRP), an mRNA binding protein that localizes to several neuronal compartments, including dendritic spines, where it may play a role in regulation of protein-synthesis-dependent synaptic plasticity (Feng et al., 1997; * Corresponding author. Fax: +1 404 727 0570. E-mail address: [email protected] (G.J. Bassell). Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter D 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2006.02.001 Antar et al., 2004). FMRP associates with over a hundred different mRNAs (Brown et al., 2001; Miyashiro et al., 2003). The absence of FMRP leads to translational dysregulation which can compromise neuronal and synaptic morphology (reviewed in Broadie and Pan, 2005). FMRP has been shown to associate with mRNAs that encode proteins regulating the cytoskeleton and synapses. One such FMRP target is the microtubule associated protein (MAP1b) mRNA, which is inappropriately translated in both Drosophila dFmr1 (dfxr) null (Zhang et al., 2001a,b; Pan et al., 2004) and mouse FMR1 knockout models (Brown et al., 2001; Lu et al., 2004). Furthermore, in Drosophila, genetic and biochemical interactions have been observed between dFMRP and the small GTPase Rac1 which regulate the actin cytoskeleton (Schenck et al., 2003). Furthermore, in Drosophila, dFMRP was shown to repress translation of profilin mRNA, encoding a regulatory actin binding protein (Reeve et al., 2005). In addition, dFmr1 mRNA interacts with the mRNA encoding the small GTPase Rac1 (Lee et al., 2003). It remains unknown whether these dFMRP targets are also bound by mammalian FMRP. In murine fibroblasts, FMRP binds to the 5VUTR of mRNA encoding protein phosphatase 2A catalytic subunit (PP2Ac), a cofilin phosphatase (Castets et al., 2005). In mouse brain, FMRP is associated with mRNA encoding calcium calmodulin-dependent protein kinase IIa mRNA (Zalfa et al., 2003), which is known to be translated at synapses (Scheetz et al., 2000). In cultured neurons from FMR1 knockout mice, there is deficient activity-induced synthesis of postsynaptic density protein PSD-95 (Todd et al., 2003). Collectively, these studies suggest a role for FMRP in the local translation of proteins important for regulation of cytoskeletal and synaptic structure. Dendritic spines are the major postsynaptic locus of excitatory synaptic innervation in the brain (Yuste and Bonhoeffer, 2004). Within these specialized compartments, local protein synthesis may drive synapse-specific plasticity underlying brain development, learning and memory (Steward and Worley, 2002). The loss of the mRNA binding protein FMRP gives rise to an abnormal dendritic spine phenotype that has been characterized by long, thin 38 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 immature looking spines in both Fragile X patients and FMR1 knockout mice (Irwin et al., 2000, 2001; Greenough et al., 2001). In Golgi-stained sections from FMR1 KO mice, there also appears to be an increase in total spine density in vivo (Irwin et al., 2002); however, this phenotype was only transient during postnatal development in a subsequent study (Nimchinsky et al., 2001). The spine phenotype in FXS may be due to altered translational regulation needed for spine development and maturation of morphologic form during a critical period. FMRP may be regulated by neuronal activity, specifically glutamatergic signals known to affect dendritic spines and synaptic plasticity. Activation of metabotropic glutamate receptors (mGluR) can stimulate the local synthesis of FMRP (Weiler et al., 1997) and also promote its trafficking from the soma into dendrites (Antar et al., 2004, 2005). mGluR activation is also associated with a protein-synthesis-dependent lengthening of dendritic spines (Vanderklish and Edelman, 2002) and long-term depression LTD at hippocampal synapses (Huber et al., 2001). Interestingly, in FMR1 knockout mice, there is an exaggerated mGluR-dependent LTD (Huber et al., 2002). This suggests that mGluR signaling affects learning and memory in a pathway that involves FMRP. In this study, we have investigated the localization and function of FMRP during hippocampal neuronal development in culture. Here, we report the presence of FMRP in growth cones of developing axons, as well as within distal segments of mature axons that innervate dendrites. We also show that FMRP-associated MAP1b mRNA is localized to axon growth cones. Analysis of FMR1 KO neurons revealed altered growth cone morphology and motility and loss of activity-dependent regulation during spine synapse formation. We show that FMRP also controls morphologic changes of filopodia and spines during activity-dependent synaptogenesis. This research is significant for understanding the role of FMRP in regulation of neuronal morphology and developmental plasticity and the impairments in these processes that contribute to Fragile X syndrome. Results High resolution localization of FMRP in dendrites, axons and spine synapses We have previously shown that FMRP is distributed in granules within dendrites and spines of cultured rat hippocampal neurons (Antar et al., 2004). Quantitative analysis indicated that over 70% of spine synapses, defined as F-actin-rich protrusions colocalized with synapsin, contained FMRP. Here, we have cultured hippocampal neurons from newborn mice isolated from WT and FMR1 KO. Fluorescence imaging depicted phalloidin staining of F-actin (green) that labeled dendritic surface protrusions (Fig. 1A). FMRP was distributed in granules throughout the dendrites, including distal branches (Fig. 1B). Higher magnification analysis of deconvolved and 3D-reconstructed dendritic subregions depicted FMRP signal within phalloidin-labeled spines (Fig. 1E, arrows). FMRP granules (red) were often colocalized to sites of synaptic contacts (Figs. 1E, F), as identified with anti-synapsin (blue). Of interest, FMRP was also detected in the thinner axonal processes; one such distal axon branch is shown depicting fifteen FMRP granules (Fig. 1F, yellow arrowheads). As a control, we did not observe FMRP immunostaining in dendrites or axons from FMR1 KO neurons (Fig. 1H). High resolution analysis of dendrite and spine morphology in WT and FMR1 KO The morphologic appearance of dendritic surface protrusions, in wild-type and FMR1 knockout neurons, was visualized using high resolution immunofluorescence and 3D reconstruction. In one approach, WT and FMR1 KO neurons were triple stained with phalloidin, synapsin and FMRP (Fig. 1). In the second scheme, neurons were triple stained with phalloidin, MAP2 and synapsin (Fig. 2). Fluorescence images were acquired through a Z-series, deconvolved and 3D-reconstructed. Visual analysis of 3D reconstructions frequently depicted an excess of long, thin dendritic protrusions in FMR1 KO, compared to WT, and these protrusions were often not associated with synapsin puncta (Figs. 1K, L—black arrowheads; Figs. 2K, L—black arrowheads). Spine synapses, as defined as stubby or long protrusions, colocalized with synapsin, were more frequent in WT dendrites than KO. In our quantitative analysis of protrusion density, those having a long and thin morphology were designated as filopodia – spines (Fig. 3A), as done by others (Prange and Murphy, 2001), since it is difficult during this stage of development in culture (2 weeks) to unequivocally distinguish spines from filopodium based solely on morphologic criteria. This is because filopodia are abundant and many spines have an ambiguous morphology (long, thin filopodiallike morphology, often lacking an obvious terminal swelling or bulbous head). FMR1 KO neurons had 99.44% more dendritic protrusions (filopodial – spines) than their WT counterparts (WT: 2.88 T 0.25 vs. KO: 4.88 T 0.07 per 10 Am, P < 0.0004, Student’s t test). In contrast, quantitative analysis of those protrusions which colocalized with synapsin, i.e. spine synapses, showed that KO had a 60.16% decrease in their overall number (Fig. 3B) (WT: 4.02 T 0.38 vs. KO: 2.51 T 0.22, P < 0.0010, Student’s t test). In order to determine if the density of protrusion associated with presynaptic terminals differed by morphology, they were further divided into two morphologic categories: ‘‘short’’ or ‘‘long’’. In both cases, there was a significant diminution of dendritic protrusions associated with synapsin in the KO (Figs. 3C, D) (long protrusions/synapsin: 1.66 T 0.186 WT vs. 0.8561 T 0.137, P < 0.0009; short protrusions/synapsin: 2.37 T 0.25 WT vs. 1.66 T 0.17, P < 0.0243, Student’s t test). Decreased protrusion/synapsin density in the FMR1 KO was not due to an overall decrease in total synapse density (WT 9.99 T 0.98 vs. KO 8.42 T 0.52, P = 0.1562, Student’s t test). Note that the vast majority of synapses are shaft synapses, and there was no statistically significant difference in the total density of synapsin puncta (n = 400) following analyses of over fifteen neurons (two dendrites per neuron). FMR1 KO neurons have loss of activity-dependent regulation of filopodia – spine and spine synapse number We examined whether KCl stimulation affects protrusion number differently in FMR1 KO neurons compared to WT. We quantified both the total density of protrusions (filopodial – spines) (Fig. 3A) and protrusions that did colocalize with synapsin (Figs. 3B, C, D). In WT cultures, there was a significant increase (56.94%) in protrusion density after KClinduced depolarization (2.88 T 0.25 vs. 4.52 T 0.51, P < 0.014, L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 39 Fig. 1. High resolution localization of FMRP within dendrites, axons and synapses of cultured mouse hippocampal neurons (16 DIV). (A – F) Wild-type (WT) neuron showing triple label detection of F-actin using FITC-phalloidin (A, green), anti-FMRP (B, red) and anti-synapsin (C, blue). Optical sections were deconvolved and 3D-reconstructed (see Experimental methods). Overlay of all three (D) depicts two regions of interest (insets e, f) enlarged in panels E and F. (E) FMRP granules were distributed throughout the dendrite and were detectable in bulbous spines (white arrows) and long spines (yellow arrow). FMRP granules (red) often colocalized with synaptic contacts (blue). (F) FMRP granules were present in both the thicker dendrite, often clustered beneath synapses (white arrowheads), as well as within the thinner distal axonal branches (yellow arrowheads) that made contacts with the dendrite. (G – L) FMR1 KO neuron showing triple label detection of F-actin (G, green), anti-FMRP (H, red) and anti-synapsin (I, blue). (H) FMRP immunostaining was not detectable in KO neurons. (J – L) Dendrites from FMR1 KO neurons displayed excess of long protrusions (black arrowheads) that did not appear to have synaptic contacts, despite the abundance of synaptic contacts (blue) along the dendritic shaft. 40 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 Fig. 2. High resolution analysis of dendritic and spine morphology in WT and FMR1 KO neurons (16 DIV). (A – F) Wild-type (WT) neuron showing triple label detection of F-actin using FITC-phalloidin (A, green), anti-synapsin (B, red) and anti-MAP2 (C, blue). Optical sections were deconvolved and 3D-reconstructed (see Experimental methods). Overlay of all three (D) depicts two regions of interest (insets e, f) enlarged in panels E and F. (E) Detection of MAP2 filled the dendritic shaft (blue), whereas F-actin marked spine-like protrusions (green) that were short and stubby (white arrows) or long and thin (yellow arrowhead); both types juxtaposed to synaptic contacts (red). Long, thin spines were occasionally noted that did not colocalize with anti-synapsin (black arrowhead). (G – L) In contrast, FMR1 KO neurons displayed an excess of long protrusions, having either filopodial form or spine-like terminal swellings, which were not colocalized with synaptic contacts (black arrowheads in panels K and L). FMR1 KO neurons less frequently displayed long and thin protrusions (yellow arrowhead) or short and stubby spines (white arrowhead) that were contacted on their surface by anti-synapsin puncta (red). Student’s t test), but in KO cultures, the already high numbers of protrusions occluded any further significant increase by KCl (Fig. 3A). Similarly, the density of protrusions/synapsin in WT neurons increased upon KCl stimulation by 52% (Fig. 3B, no drug: 4.02 T 0.37 vs. stimulus: 6.12 T 0.399, P < 0.0004, Student’s t test), whereas the density of protrusions/synapsin from KO neurons did not respond to KCl-induced depolarization (no drug: 2.52 T 0.22 vs. stimulus: 2.36 T 0.25, P < 0.0006, Student’s t test). In the KO, the absence of KCl-induced increases in protrusion/synapsin density was apparent from both L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 41 Fig. 3. FMR1 KO neurons show impaired activity-dependent regulation of total dendritic protrusions: filopodia and spines. (A) Quantitative analysis of total long, thin protrusions (designated filopodia – spines) indicated that KO neurons have increased density compared to WT. In response to KCl depolarization, WT dendrites extrude increased numbers of filopodial – spine protrusions, whereas further KCl-induced increases were occluded in FMR1 KO neurons by already high number of protrusions. This analysis excluded short and stubby protrusions. (B) The density of protrusions in contact with a synapsin punctum was reduced in the KO compared to WT. KCl depolarization increased protrusion (synapsin positive) density in WT, but not FMR1 KO neurons. (C, D) Similarly, decreased protrusion (synapsin positive) density and absence of KCl-induced increases were also observed when protrusions were subclassified as long and thin (C) or short and stubby that lacked a stem (D); both colocalized with synapsin puncta. types of classification: long, short spine synapses (Figs. 3C, D). These results indicate that neuronal activity can stimulate the growth of dendritic protrusions, likely both filopodia and spines (including spine synapses), yet FMR1 KO neurons are deficient in these morphologic responses. Instead, the KO phenotype is characterized by an excess of apparently uninnervated protrusions and a reduction in spine synapses. Localization and function of FMRP at the axonal growth cone In younger neurons (4 DIV), FMRP granules localized to both developing dendrites and axons and were detectable at distal sites within growth cones. Examination of a polarized neuron is shown in Fig. 4 that depicts the presence of FMRP granules in an axon that is 340 Am in length. FMRP granules distributed to the distal-most axon and growth cone where it extended into filopodial tips (Fig. 4E). We also performed fluorescence in situ hybridization (FISH) using oligonucleotide probes to MAP1b mRNA, a known FMRP target mRNA (Darnell et al., 2001; Lu et al., 2004; Antar et al., 2005), and similarly demonstrated that it, too, is detectable in growth cones of developing axons (Fig. 5). Next, we analyzed the density of filopodia on growth cones of developing neurites at early stages in culture (4 DIV), in neurons cultured from WT or FMR1 KO mice. There was a hyperabundance of filopodia emerging from growth cone heads of FMR1 KO neurons compared to their WT counterparts (Fig. 6). This increase in filopodial number was also observed during timelapse video microscopy (see Supplemental data). Five images were taken from corresponding timepoints in each 15-min movie and averaged to represent the mean number of filopodia in that growth cone. Quantification revealed that FMR1 KO growth cones contain significantly more filopodia than their WT counterparts in live neurons (KO 13.11 T 1.51; WT 8.50 T 1.09; P = 0.0001, Student’s t test). This dynamic analysis of filopodial excess in live KO neurons compliments the data done on fixed cells. We note that the increased density of growth cone filopodia was not attributed to changes in the overall area of the growth cone (WT 109.04 T 16.34, KO 112.31 T 19.87, Student’s t test) expressed as variance over mean (Fig. 6D). To determine if the filopodial phenotype from FMR1 KO neurons was reversible, EGFP – FMRP or EGFP alone was transfected and allowed to express overnight (Fig. 7). To visualize F-actin containing filopodia, transfected neurons were stained with rhodamine-phalloidin (Figs. 7A, B). We observed that FMR1 KO neurons expressing EGFP – FMRP had reduced number of growth cone filopodia (6.38 T 0.45) compared to cells express EGFP alone (13.22 T 1.05) (Fig. 7C). Filopodial density in KO expressing EGFP – FMRP was even less than non-transfected WT neurons (8.50 T 1.09; see Fig. 6C), perhaps because overexpressed EGFP – FMRP, in rescued KO neurons, is present at higher levels than endogenous FMRP in WT neurons. Functional differences in FMR1 KO and WT neurons were shown to include significant differences in growth cone motility as measured by total growth cone distance (absolute value) traveled in microns. Movement of growth cone centroids of both FMR1 KO and WT mice were tracked on their x and y axes. Histories shown for WT and FMR1 KO growth cones reveal tighter clustering of the centroid in the FMR1 KO growth cone when compared to the more dynamic behavior of the WT growth cone (Fig. 8A). Then, all growth cone x, y coordinates were averaged together to examine total distance traveled, as a measure of growth 42 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 Discussion Local functions for FMRP in regulation of neuronal morphology during development In cultured hippocampal neurons, FMRP was localized to both growth cones of developing axons and spine synapses within dendrites and axons. In that neuronal activity and specific signals can stimulate FMRP trafficking within dendrites and synapses (Antar et al., 2004, 2005), the localization of FMRP may be essential for its function in control of neuronal morphology. In this study, we observe that FMR1 KO neurons display excessive growth cone filopodia and dendritic filopodia – spines. In addition, there was loss of growth cone dynamics (in young neurons) and inability of dendrites to respond to activity and sculpt new protrusions, including spine synapses. Our findings of excess filopodia and reduced growth cone dynamics in neurons from the FMR1 knockout mouse have some parallels to morphologic impairments observed in the dFmr1 (dfxr) null fly. In the fly, the dfxr phenotype includes axonal overgrowth of muscle, enlarged presynaptic terminals (Zhang et al., 2001a,b), excessive axonal branching and increased architectural complexity (Pan et al., 2004). Collectively, these studies indicate a broad role of FMRP as regulator of neuronal morphology during development. These observations have broader implications for understanding the pathogenesis of Fragile X syndrome. A possible role for FMRP in spine development and spine synapse stabilization Fig. 4. Localization of FMRP to distal axon and growth cone. Cultured WT neurons were fixed (4 DIV) and processed for immunofluorescence detection of FMRP (red) and F-actin (green). (A) Three overlapping DIC images of a polarized neuron were acquired at low magnification and merged to show entire neuron and its processes. This axon is 340 Am in length. The axon growth cone (inset) was imaged at higher magnification to depict F-actin (B, green) and presence of FMRP granules (C, red). (D, E) Image reconstruction of deconvolved Z-series shows merge of FMRP granules (yellow arrowheads) and F-actin (green) in growth cone filopodia (inset from panel D is enlarged in panel E). cone motility, which demonstrated that FMR1 KO growth cones had diminished rate of movements (protrusive and retractive) over time (Fig. 8B). The spine phenotype exhibited in FXS and in FMR1 KO mice has been extensively studied (Irwin et al., 2000, 2001, 2002). Through Golgi impregnation of neurons, it has been shown, both in humans and FMR1 KO mice, that there is an abnormal elevation in protrusion number and an accompanying morphologic anomaly: overly long, thin protrusions (Greenough et al., 2001). Additionally, EGFP expression of hippocampal neurons in slices has shown that this abnormal phenotype exists, only transiently in the first postnatal week (Nimchinsky et al., 2001). However, these studies did not examine whether these excessive spines were actually innervated. This information is important in order to understand the disease pathogenesis. Our data suggest that FMR1 KO dendrites have an excess in the total number of dendritic surface protrusions (referred to as filopodia – spines). These long protrusions include both thin spines and dendritic filopodia, which have been shown in some studies to be spine precursors (Jontes and Smith, 2000), yet other evidence indicates that they are separate structures important for formation of shaft synapses (Fiala et al., 1998). An excess of dendritic filopodia has been described in various forms of mental retardation (Purpura, 1974). Dendritic filopodia densely populate dendrites during early dendritic development, where they initiate contact with local axons, ultimately recruiting functional presynaptic boutons (Ziv and Smith, 1996). While filopodial density normally decreases following synaptogenesis (Jontes and Smith, 2000), filopodia may remain in excess in disease states, perhaps due to delayed synaptic contacts. Alternatively, an excess in filopodia in FXS may be a consequence of the loss of mature spines (Fiala et al., 1998). In contrast to the excess of long protrusions (filopodia – spines), we observed a significant reduction in the density of protrusions L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 43 Fig. 5. Localization of MAP1b mRNA granules in axonal growth cones. Cultured neurons were fixed (4 DIV) and processed for fluorescence in situ hybridization (FISH) using digoxigenin-labeled oligonucleotide probes which were detected by immunofluorescence. (A) DIC image of neuron and axonal growth cone (inset) is enlarged at the right showing (B) DIC, (C) FISH and (D) merge. MAP1b mRNA granules are detected in the axon shaft and growth cone. (E – H) Another axon growth cone is shown that has navigated upward to contact a cell body from another neuron. (G) MAP1b mRNA granules are present in the growth cone. (I – L) Control neuron that was hybridized with sense probe revealing only sparse background signal (K, L). 44 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 Fig. 6. Hyperabundance of filopodia emerges from growth cones of cultured hippocampal neurons (3 DIV) from FMR1 KO. Selected phase images from timelapse video-microscopy show growth cones from (A) WT and (B) FMR1 KO neurons (micron bars, 5 Am). (C) Quantitative analysis shows that growth cones from FMR1 KO neurons contained significantly more filopodia than their WT counterparts (P < 0.0001). (D) There was no difference in growth cone area between FMR1 KO and WT neurons. See Supplementary data. that contain synapsin immunoreactive presynaptic terminals, suggesting a reduction in spine synapse number in the FMR1 KO. Our observations of spine synapse loss are consistent with morphologic and physiological findings of a delay in the formation of functional spines in hippocampal neurons from FMR1 KO (Braun and Segall, 2000). During the first week in culture, KO neurons do not form synaptic contacts as quickly as WT, as determined through measurement of spontaneous synaptic activity. Furthermore, KO cultures have fewer mono- and poly-synaptic connections at 2 – 3 weeks in culture, as determined by a longer duration to afferent stimulation in WT than KO and by a smaller total number of excitatory events per response in KO (Braun and Segall, 2000). It has been hypothesized that the structural and functional defects in FXS may result from impaired metabotropic glutamatereceptor-dependent plasticity (Huber et al., 2002; Bear et al., 2004). The potential spine loss associated with exaggerated LTD may be followed by excess growth of immature and poorly innervated spines. The finding of diminished spines with mature bulbous morphology (Irwin et al., 2000) may also account for the low numbers of AMPARs found in synaptosomes from cerebral cortex of FMR1 KO animals (Li et al., 2002). There may be fewer AMPARs because there are excessive filopodia or immature spines that are devoid of AMPARs and fewer mature spines that do house AMPARs. While a number of studies indicate that filopodial and spine outgrowth are driven by neuronal activity and glutamatergic signals (Jontes and Smith, 2000), our findings suggest that the inter-relationships between these structures can be modulated by FMRP. We show here that KCl depolarization can promote increases in both the density of filopodia and spines. However, in the FMR1 KO, the already high levels of these protrusions occluded any further addition in response to KCl. One speculation is that FMRP may act to limit or repress morphologic changes at basal states and permit activity-dependent changes in synaptic connections. Possible FMRP-mediated translation involved in spine development and stabilization Future analysis of the FMR1 KO phenotype may reveal impaired activity-dependent translation of proteins that are needed for spine synapse maturation or stabilization, perhaps including those proteins involved in the assembly of the postsynaptic density and/or regulation of glutamate receptor insertion and cycling. It has been noted that there appears to be an excess of protein synthesis in synaptosomes isolated from FMR1 knockout mice (Zalfa et al., 2003). CaMKIIa and Arc mRNAs were both abnormally elevated in polyribosomes fractions from FMR1 KO brain (Zalfa et al., 2003). It will be interesting to discern if the excess in protein synthesis under basal states occludes any further stimulus-induced translation needed for filopodial conversion or spine maturation. In support of this idea, FMR1 KO neurons have reduced mGluRdependent translation of PSD-95 (Todd et al., 2003), which could impair the ability to enrich PSD-95 at developing synapses and impair spine development. L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 45 Fig. 7. Transfection of human FMRP (EGFP fusion) into FMR1 KO neurons rescued the growth cone filopodial phenotype. The images show phalloidin staining of F-actin in FMR1 KO neurons transfected with the marker EGFP (not shown). (A) FMRI KO neurons transfected with EGFP show an abnormally increased number of growth cone filopodia like untransfected neurons. (B) KO neurons transfected with EGFP – FMRP show a normal number of growth cone filopodia, comparable to the number seen in WT cells. (C) Quantification of filopodial numbers depicted in panels A and B. The filopodial phenotype of FMR1 KO neurons is recapitulated in the growth cone Here, we report the localization of FMRP granules to the leading edge of axonal growth cones. Analysis of growth cones from the FMR1 KO at 4 DIV using time-lapse microscopy of live neurons revealed an excess of filopodia, analogous to the dendritic phenotype of more mature neurons. In addition, we observed that growth cones from FMR1 KO neurons were much less dynamic. These exhibited a net decrease in the total distance traveled, as measured by summating forward and rearward displacements (absolute values) of the growth cone center and dividing by time. While it is clear that local protein synthesis can affect chemotropic responses of growth cones to axon guidance molecules (Campbell and Holt, 2001), the identity of the mRNAs involved in this response has not been well characterized. One example is the localization of h-actin mRNA to growth cones that is mediated by binding of the zipcode by the mRNA binding protein ZBP1 (Zhang et al., 2001b). Disruption of this interaction results in growth cones that cannot protrude and often show retractive behavior (Zhang et al., 2001b). However, this phenotype is very different from that described here for FMR1 KO neurons, where net extension is unaffected, but there is failure to display dynamic cycles of protrusion and retraction during net neuritic growth. The growth cone phenotype of FMR1 KO neurons likely results from impaired translation of many FMRP-target mRNAs. One attractive candidate mRNA is microtubule associated protein MAP1B mRNA (Darnell et al., 2001). In cultured neurons from FMR1 knockout mice, there was excessive translation of MAP1b mRNA and delayed down-regulation of MAP1b protein during development (Lu et al., 2004). The aberrantly elevated MAP1b protein was correlated with abnormally increased microtubule stability in FMR1 knockout neurons. Here, we also show that MAP1b mRNA is localized to axon growth cones. It will be interesting to test whether altered local regulation of MAP1b mRNA in growth cones contributes to their impaired motility in FMR1 KO. Loss of FMRP may result in impaired regulation of Rho GTPases that control the actin cytoskeleton (Schenck et al., 2003). It is known that FMRP and dFMRP also bind and regulate translation of mRNAs encoding proteins affecting F-actin assembly, including Rac1, cofilin phosphatase and profilin (Lee et al., 2003; Castets et al., 2005; Reeve et al., 2005). It is of interest that mutations of PAK3 (p21-activated kinase 3), which is in the same pathway as Rac1 and cofilin, also lead to mental retardation, and its genetic loss in cultured neurons results in excess of filopodial protrusions and decreased density of mature spine synapses (Boda et al., 2004). These and other studies provide interesting links between Rho proteins, spine development and mental retardation (van Galen and Ramakers, 2005) and suggest prolonged retention of dendritic filopodia and delayed spine synapse development as a common feature of mental retardation. It will be interesting to know whether dysregulation of these actin pathways also leads to 46 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 decapitated and hippocampi removed and dissociated. Cells from KO and WT cultures were determined to have comparable survival rates and were plated at 50K cells/60-mm dish. Neurons were plated on poly-l-lysinecoated coverslips (1.0 mg/ml), either on 15-mm glass coverslips for immunofluorescence and in situ hybridization or onto Bioptechs (Bioptechs, Inc., Butler, PA) coverslips for live cell imaging. Neurons were attached to the substrate in minimal essential medium (MEM) with FBS (10%) for 2 h, inverted onto dishes containing astroglia and grown in defined Neurobasal Medium (Gibco, Grand Island, NY) with Glutamax (Gibco) and B-27 supplements (Gibco) (Goslin et al., 1998), except as noted. Cells, control or drug-treated, were fixed with 4% paraformaldehyde in 1 PBS at RT for 18 min or processed for live cell imaging. Drug treatments Bath application of 10 mM KCl was done for 30 min directly in the culture dishes containing coverslips of hippocampal neurons. Immunofluorescence Immunofluorescence (IF) was performed as described previously (Antar et al., 2004) on 16 DIV cultures for filopodial and spine analysis and 4 DIV for growth cone analysis. For primary antibody incubations (1 h, RT), FMRP was detected with mouse antibody (1C3; 1:500, Chemicon, Temecula, CA) and synapsin with a polyclonal antibody (1:500, Sigma). For secondary antibody incubations (1 h, RT), a Cy3 or Cy5 flourochromeconjugated anti-mouse or anti-rabbit antibody was used (1:750) (Jackson ImmunoResearch, West Grove, PA). Alexa 488-conjugated phalloidin (or TRITC phalloidin for EGFP-transfected cells) was used to stain F-actin (1:500; Molecular Probes, Eugene, Oregon). Fluorescence in situ hybridization (FISH) Fig. 8. Growth cones from FMR1 knockout neurons have impaired dynamics and speed. (A) x – y coordinates were plotted every 15 s for each growth cone centroid over 15 min. Lines connect the centroid pathway over the time course. Histories are shown for WT and FMR1 KO growth cones. Note the tight clustering of the centroid in the FMR1 KO growth cone when compared to the more dynamic behavior of the WT growth cone. This difference appears to be facilitated by an increase in motility. (B) Total growth cone movement (protrusion and regression) was tracked every 15 s for 15 min from live KO and WT neurons at 3 DIV. Each point represents the average motility of several growth cones by measuring movement of centroids (geometric centers) of each growth cone over 1 min. FMR1 KO growth cones had significantly diminished growth cone motility ( P < 0.05). The total distance traveled with unweighted averages is depicted in the inset ( P < 0.05). impaired axon growth cone and presynaptic innervation in FXS. Thus, the phenotype of FXS may be broader in scope than previously thought, having both dendritic and axonal phenotypes that converge at the developing synapse. Experimental methods Five antisense oligonucleotide probes (50 nts) were designed to mouse microtubule associated protein MAP1b mRNA (see Supplementary data). Sense oligonucleotides were synthesized as negative controls. Oligonucleotides were synthesized on a DNA synthesizer incorporating four amino-modified thymidines (C6dT), purified and chemically labeled using digoxigenin succinamide ester (Roche Molecular Biochemicals) as described previously (Antar et al., 2004). In situ hybridization was completed as previously described (Antar et al., 2004, 2005). The digoxigenin-labeled oligonucleotide probes were detected by immunofluorescence using Cy3-conjugated monoclonal antibody to digoxigenin and Cy3-conjugated anti-mouse antibody (Jackson ImmunoResearch) as described previously (Antar et al., 2004). Coverslips were mounted with gelvatol with n-propyl gallate (6 mg/ml) as an anti-bleaching agent. Image acquisition and analysis Fluorescence was visualized using 60 or 40 Plan-Neofluar objectives, 100 W mercury arc lamp and HiQ bandpass filters (Chroma Tech) on a Nikon Eclipse inverted microscope. Images were captured with a cooled CCD camera (Quantix, Photometrics) from eight cultures using IP Lab software (Scanalytics). Neurons labeled by triple label fluorescence were imaged in each channel along the z axis and deconvolved using a 3D blind algorithm (Autoquant X, Bitplane). Images were thresholded, superimposed and registered using fiduciary beads present in the mounting medium. Volume rendering and 3D reconstruction were performed using Imaris software (Bitplane, Inc. USA). Hippocampal culture Morphologic definitions Hippocampi were dissected and cultured from hemizygous male and homozygous female FMR1 KO mice ( P 0 – P 1) and their wild-type counterparts of the same genetic background, birthed from separate litters on the same day (Jackson Lab, Bar Harbor, ME). Paired wild-type and KO experiments were performed on the same day at the same time using cells grown on the same glia and medium in a co-culture system. P0 mice were Protrusions having a long, thin morphology were designated as filopodia – spines (Fig. 3A), as done by others (Prange and Murphy, 2001), since it is difficult during this stage of development in culture (2 weeks) to unequivocally distinguish spines from filopodium based solely on morphologic criteria. This is because filopodia are abundant and spines often have L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 47 an ambiguous morphology (long, thin filopodial-like morphology, often lacking an obvious terminal swelling or bulbous head). Dendritic protrusions that were juxtaposed to synapsin-positive punctum were designated ‘‘protrusions/synapsin’’ (Fig. 3B). These were further subclassified as ‘‘long protrusions/synapsin’’ (Fig. 3C) or ‘‘short protrusions/synapsin’’ (Fig. 3D), this later category likely representing spine synapses having a bulbous or stubby morphology with a short neck or lacking a visible neck. Data for protrusion density measurements were collected from a single primary and two secondary dendrites, the former measured at least 10 Am from the cell soma (for statistical analysis, n = protrusions per 10 Am of dendrite). WT neurons and KO neurons were examined from 6 separate cultures, ten to fifteen neurons per experimental condition per culture. For each condition, this analysis involved the scoring of over 300 protrusions. Xing for assistance with figure preparation. We also thank Steve Warren for FMR1 knockout mice. This work was supported by FRAXA fellowship to L. Antar and NIH NS051127 and Dana Foundation awards to G. Bassell. Live cell imaging References Mouse hippocampal neurons were cultured on 40 mm coverslips (Bioptechs, Inc.) for 4 days to examine growth cones. These cells were imaged in Leibovitz’ L15 medium (Gibco, Grand Island, NY) supplemented with 5% FBS in a 37-C, closed Bioptechs FCS2 chamber (Bioptechs, Inc) with a heated 60 Plan-Neofluar objective configured to a Nikon Eclipse inverted microscope. Images were acquired with a cooled CCD camera (Quantix, Photometrics) using IP Lab software (Scanalytics). Images were captured every 15 s for 60 frames over 15 min or 120 frames over 30 min using IP Lab Software (Scanalytics). Between one to two neurons were imaged per coverslip, two coverslips were used per condition per session in order to minimize neuronal phototoxicity. Three to four WT and three to four KO neurons were examined each session, for a total ‘‘n’’ of 12 – 16 neurons examined each for WT and KO cultures. From the time-lapse data, the centroid (geometric center) of each growth cone was calculated and a centroid plot of x – y coordinates was generated. From these values, yx and yy were determined for 60 frames, taken every 15 s, per growth cone and distances and velocities determined from these parameters. Filopodial numbers were derived by counting averages of filopodia from five equidistant frames over the course of the time-lapse. Area was determined by tracing growth cones at 1-min intervals for 15 min then averaging areas. Variance in area was calculated for each growth cone, and area was expressed as variance in area over mean area. For KO and WT analyses, 10 – 16 cells were examined per condition. KO and WT experiments used mice from eight different cultures (4 KO and 4 WT). Student’s t tests using independent samples (Statistica) were used where each variable contains the data for one group (Statistica) to examine data comparing two values. All statistics are reported or depicted with their SEM in text and figures. Antar, L.N., Afroz, R., Dictenberg, J.B., Carroll, R.C., Bassell, G.J., 2004. Metabotropic glutamate receptor activation regulates fragile x mental retardation protein and FMR1 mRNA localization differentially in dendrites and at synapses. J. Neurosci. 24, 2648 – 2655. Antar, L.N., Dictenberg, J.B., Plociniak, M., Afroz, R., Bassell, G.J., 2005. Localization of FMRP-associated mRNA granules and requirement to microtubules for activity-dependent trafficking in hippocampal neurons. Genes Brain Behav. 4 (6), 350 – 359. Bear, M.F., Huber, K.M., Warren, S.T., 2004. The mGluR theory of fragile X mental retardation. Trends Neurosci. 27, 370 – 377. Boda, B., Alberi, S., Nikonenko, I., Node-Langlois, R., Jourdain, P., Moosmayer, M., Parisi-Jourdain, L., Muller, D., 2004. The mental retardation protein PAK3 contributes to synapse formation and plasticity in hippocampus. J. Neurosci. 24, 10816 – 10825. Braun, K., Segall, M., 2000. FMRP involvement in formation of synapses among cultured hippocampal neurons. Cereb. Cortex, 1045 – 1052. Broadie, K., Pan, L., 2005. Translational complexity of the fragile x mental retardation protein: insights from the fly. Mol. Cell 17, 757 – 759. Brown, V., Jin, P., Ceman, S., Darnell, J.C., ODonnell, W.T., Tenenbaum, S.A., Jin, X., Feng, Y., Wilkinson, K.D., Keene, J.D., Darnell, J.C., Warren, S.T., 2001. Microarray identification of FMRP associated brain mRNAs and altered mRNA translational profiles in Fragile X Syndrome. Cell 107, 477 – 487. Campbell, D.S., Holt, C.E., 2001. Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron 32, 1013 – 1026. Castets, M., Schaeffer, C., Bechara, E., Schenck, A., Khandjian, E.W., Luche, S., Moine, H., Rabilloud, T., Mandel, J.L., Bardoni, B., 2005. FMRP interferes with the Rac1 pathway and controls actin cytoskeleton dynamics in murine fibroblasts. Hum. Mol. Genet. 14, 835 – 844. Darnell, J.C., Jensen, K.B., Jin, P., Brown, V., Warren, S.T., Darnell, R.B., 2001. Fragile X Mental Retardation Protein targets G Quartet mRNAs important for neuronal function. Cell 107, 489 – 499. Feng, Y., Gutekunst, C.A., Eberhart, D.E., Yi, H., Warren, S.T., 1997. FMRP: nucleocytoplasmic shuttling and association with somatodendritic polyribosomes. J. Neurosci 17, 1539 – 1547. Fiala, J.C., Feinberg, M., Popov, V., Harris, K.M., 1998. Synaptogenesis via dendritic filopodia in developing hippocampal area CA1. J. Neuroscience 18, 8900 – 8911. Goslin, K., Asmussen, H., Banker, G., 1998. Rat hippocampal neurons in low density culture. In: Banker, G., Golsin, K. (Eds.), Culturing Nerve Cells, 2nd edR MIT Press, Cambridge, pp. 339 – 371. Greenough, W.T., Klintsova, A.Y., Irwin, S.A., Galvez, R., Bates, K.E., Weiler, I.J., 2001. Synaptic regulation of protein synthesis and the fragile X protein. Proc. Natl. Acad. Sci. U. S. A. 98, 7101 – 7106. Huber, K.M., Roder, J.C., Bear, M.F., 2001. Chemical induction of mGluR5- and protein synthesis-dependent long-term depression in hippocampal area CA1. J. Neurophysiol. 86, 321 – 325. Huber, K.M., Gallagher, S.M., Warren, S.T., Bear, M.F., 2002. Altered synaptic plasticity in a mouse model of fragile x mental retardation. Proc. Natl. Acad. Sci. 99, 7746 – 7750. Constructs and cloning The human EGFP – FMRP behind the human FMR1 promoter was generated as follows: a 2.8-kb EcoRI/NheI fragment of the human FMR1 promoter from plasmid pE5.1 (a generous gift of Dr. David Nelson) was cloned into the EcoRI site of pEGFP-1 (BD Biosciences Clontech) to generate plasmid hpr12-9. Full-length human FMRP (iso-7 form variant lacking exon 12) was PCR-amplified using primers: F: GCGAGCTCAAGAGGAGCTGGTGGTGGAAGTGC and R: GCGAATTCTTAGGGTACTCCATTCACGAGTGG and cloned into the SacI/EcoRI sites of pEGFP-C1 (BD Biosciences Clontech) to put FMRP in frame with EGFP. From this construct and AgeI/StuI, fragment was used to replace the AgeI/ StuI insert in hpr12-9. This human EGFP – FMRP construct was transfected into hippocampal neurons using calcium phosphate and allowed to express overnight as described previously (Antar et al., 2004). Acknowledgments We thank Jennifer Darnell for the EGFP – FMRP construct subcloning and David Nelson for the Fmr1 promoter. We thank Laura Griffin for training in Imaris software and Wulin Teo and Lei Appendix A. Supplementary data Supplementary data associated with this article can be found in the online version at doi:10.1016/j.mcn.2006.02.001. 48 L.N. Antar et al. / Mol. Cell. Neurosci. 32 (2006) 37 – 48 Irwin, S.A., Galvez, R., Greenough, W.T., 2000. Dendritic spine structural anomalies in Fragile X Mental Retardation Syndrome. Cereb. Cortex 10, 1038 – 1044. Irwin, S.A., Patel, B., Idupulapati, M., Harris, J.B., Crisostomo, R.A., Larsen, B.P., Kooy, F., Willems, P.J., Cras, P., Kozlowski, P.B., Swain, R.A., Weiler, I.J., Greenough, W.T., 2001. Abnormal dendritic spine characteristics in the temporal and visual cortices of patients with fragile-X syndrome: a quantitative examination. Am. J. Med. Genet. 98, 161 – 167. Irwin, S.A., Idupulapati, M., Gilbert, M.E., Harris, J.B., Chakravarti, A.B., Rogers, E.J., Crisostomo, R.A., Larsen, B.P., Mehta, A., Alcantara, C.J., Patel, B., Swain, R.A., Weiler, I.J., Oostra, B.A., Greenough, W.T., 2002. Dendritic spine and dendritic field characteristics of layer V pyramidal neurons in the visual cortex of fragile-X knockout mice. Am. J. Med. Genet. 111, 140 – 146. Jontes, J.D., Smith, S., 2000. Filopodia, spines and the generation of synaptic diversity. Neuron 27, 11 – 14. Lee, A., Li, W., Xu, K., Bogert, B.A., Su, K., Gao, F.B., 2003. Control of dendritic development by the Drosophila fragile X-related gene involves the small GTPase Rac1. Development 130, 5543 – 5552. Li, J., Pelletier, M.R., Perez Velazquez, J.L., Carlen, P.L., 2002. Reduced cortical synaptic plasticity and GluR1 expression associated with fragile X mental retardation protein deficiency. Mol. Cell. Neurosci. 19, 138 – 151. Lu, R., Wang, H., Liang, Z., Ku, L., O’Donnell, W.T., Li, W., Warren, S.T., Feng, Y., 2004. The fragile X protein controls microtubule-associated protein 1B translation and microtubule stability in brain neuron development. Proc. Natl. Acad. Sci. U. S. A. 101, 15201 – 15206. Miyashiro, K.Y., Beckel-Mitchener, A., Purk, T.P., Becker, K.G., Barret, T., Liu, L., Carbonetto, S., Weiler, I.J., Greenough, W.T., Eberwine, J., 2003. RNA cargoes associating with FMRP reveal deficits in cellular functioning in Fmr1 null mice. Neuron 37, 417 – 431. Nimchinsky, E.A., Oberlander, A.M., Svoboda, K., 2001. Abnormal development of dendritic spines in FMR1 knock-out mice. J. Neurosci. 21, 5139 – 5146. Pan, L., Zhang, Y.Q., Woodruff, E., Broadie, K., 2004. The Drosophila fragile x gene negatively regulates neuronal elaboration and synaptic differentiation. Curr. Biol. 14, 1863 – 1870. Prange, O., Murphy, T.H., 2001. Modular transport of postsynaptic density95 clusters and association with stable spine precursors during early development of cortical neurons. J. Neurosci. 21, 9325 – 9333. Purpura, D.P., 1974. Dendritic spine dysgenesis and mental retardation. Science 186, 1126 – 1129. Reeve, S.P., Bassetto, L., Genova, G.K., Kleyner, Y., Leyssen, M., Jackson, F.R., Hassan, B.A., 2005. The Drosophila fragile X mental retardation protein controls actin dynamics by directly regulating profilin in the brain. Curr. Biol. 15, 1156 – 1163. Scheetz, A.J., Nairn, A.C., Constantine-Patton, M., 2000. NMDA receptormediated control of proteins synthesis at developing synapses. Nat. Neurosci. 3, 211 – 216. Schenck, A., Bardoni, B., Langmann, C., Harden, N., Mandel, J.L., Giangrande, A., 2003. CYFIP/Sra-1 controls neuronal connectivity in Drosophila and links the Rac1 GTPase pathway to the fragile X protein. Neuron 38, 887 – 898. Steward, O., Worley, P., 2002. Local synthesis of proteins at synaptic sites on dendrites: role in synaptic plasticity and memory consolidation? Neurobiol. Learn. Mem. 78, 508 – 527. Todd, P.K., Mack, K.J., Malter, J.S., 2003. The fragile X mental retardation protein is required for type-I metabotropic glutamate receptordependent translation of PSD-95. Proc. Natl. Acad. Sci. U. S. A. 100, 14374 – 14378. Vanderklish, P.W., Edelman, G.M., 2002. Dendritic spines elongate after stimulation of group 1 metabotropic glutamate receptors in cultured hippocampal neurons. Proc. Natl. Acad. Sci. U. S. A. 99, 1639 – 1644. van Galen, E.J., Ramakers, G.J., 2005. Rho proteins, mental retardation and the neurobiological basis of intelligence. Prog. Brain Res. 147, 295 – 317. Weiler, I.J., Irwin, S.A., Klintsova, A.Y., Spencer, C.M., Eberwine, J., Greenough, W.T., 1997. Fragile X mental retardation protein is translated near synapses. Proc. Natl. Acad. Sci. 94, 5395 – 5400. Yuste, R., Bonhoeffer, T., 2004. Genesis of dendritic spines: insights from ultrastructural and imaging studies. Nat. Rev., Neurosci. 5, 24 – 34. Zalfa, F., Giorgi, M., Primerano, B., Moro, A., Di Penta, A., Reis, S., Oostra, B., Bagni, C., 2003. The Fragile X syndrome protein FMRP associates with BC1 RNA and regulates the translation of specific mRNAs at synapses. Cell 112, 317 – 327. Zhang, H.L., Eom, T., Oleynikov, Y., Shenoy, S.M., Lieblet, D.A., Dictenberg, J.B., Singer, R.H., Bassell, G.J., 2001a. Neurotrophin induced transport of b-actin mRNP complex increases b-actin levels and stimulates growth cone motility. Neuron 31, 261 – 275. Zhang, Y.Q., Bailey, A.M., Matthies, H.J., Renden, R.B., Smith, M.A., Speese, S.D., Rubin, G.M., Broadie, K., 2001b. Drosophila Fragile Xrelated gene regulates the MAP1b homolog Futsch to control synaptic structure and function. Cell 107, 591 – 603. Ziv, N.E., Smith, S.J., 1996. Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron 17, 91 – 102.