Download Transcription and Translation

Transcription and Translation
From DNA Code to Proteins
Chapter 13 Lesson 2
Learning Goals:

We will identify the types of RNA
and their role in protein synthesis.
Standard: SC.912.L.16.5 Explain the basic processes
of transcription and translation and how they result in
the expression of genes.
Recall: DNA vs. RNA
DNA
1. Strands?
2. Sugar?
3. Bases?
RNA
1. Strands?
2. Sugar?
3. Bases?
Both contain a sugar, phosphate, and base.
Recall: DNA vs. RNA



DNA
Double stranded
Deoxyribose sugar
Bases: C,G A,T
RNA
1. Strands?
2. Sugar?
3. Bases?
Both contain a sugar, phosphate, and base.
Recall: DNA vs. RNA



DNA
Double stranded
Deoxyribose sugar
Bases: C,G A,T



RNA
Single stranded
Ribose sugar
Bases: C,G,A,U
Both contain a sugar, phosphate, and base.
Recall: DNA & the Genetic Code




DNA contains a genetic code, the
instructions to make an organism function.
DNA strands contain the nitrogen bases
Cytosine, Guanine, Adenine, and Thymine.
DNA is able to replicate itself prior to cell
division to ensure both new cells have the
same DNA.
DNA code can be used in Protein Synthesis.
What are Proteins?

Made up of amino acids.

Polypeptide- string of amino acids.

Assembled at the ribosome.

20 amino acids are arranged in
different orders to make a variety of
proteins.
What is Protein Synthesis?

Process by which DNA codes are turned
into proteins for the body to use.
2 Steps:
 Transcription - Creating mRNA with
DNA’s code
 Translation – Using mRNA’s code &
ribosomes to create proteins.
Recall: Transcription




Transcription is the first step in Protein
Synthesis.
Occurs in the nucleus.
Segments of DNA code serve as templates to
produce messenger RNA (mRNA) molecules.
mRNA contains the nitrogen bases Cytosine,
Guanine, Adenine, and Uracil instead of Thymine.
Check Point Question:

If a template DNA strand is
TACGATACGAT, what is the mRNA
code?
Check Point Question:

If a template DNA strand is
TACGATACGAT, what is the mRNA
code?
AUGCUAUGCUA
mRNA Processing
Prior to leaving the nucleus, the mRNA must
be modified
 DNA sequence has
coding regions (exons)
Newly made mRNA strand
and non-coding
regions (introns)
Exon Intron
Exon Intron

Intron

Intron
Exon
Intron
Exon
Modified mRNA strand
Intron
Introns must be
removed before
mRNA and can leave
nucleus
Transcription to Translation



Once the mRNA has been modified, it
can then leave the nucleus to be used
by the ribosome to make proteins.
Translation is the process by which a
ribosome uses the mRNA message to
produce a specific amino acid chain
(polypeptide protein).
Occurs outside the
nucleus in the
cytoplasm.
Translation – Codons & Amino Acids


The ribosome reads the code three
letters at a time. These three letters
are called codons.
Each codon codes for a particular
amino acid.
Check Point Question

How many codons are in this
particular sequence:
AUGAACUCUGCCUAAGCGUAU
Check Point Question

How many codons are in this
particular sequence:
Seven:
AUG AAC UCU GCC UAA GCG UAU
Translation - Codons

Codons code for particular amino
acids, those amino acids are the
building blocks of _______.
Translation - Codons

Codons code for particular amino
acids, those amino acids are the
building blocks of Proteins.
Translation - Codons

We can use codon charts to
determine which codons code for
which particular amino acids.
Ribosomes



Ribosomes read codons
without codon charts
They use the sequence
of codons on mRNA
and the assistance of
tRNA to assemble
amino acids into
polypeptide chains.
Recall Question: What is the role of the tRNA?
Welcome Transfer RNA (tRNA)!


tRNA brings the
amino acids to the
ribosome.
An Anticodon on the
other end matches
with the mRNA’s
code.
Three different views:
Translation: The Finale

The polypeptide chain
grows until it reaches
a stop codon, the
polypeptide chain is
released and folded
into a protein.
Transcription and Translation: Review
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.___ is copied onto
messenger RNA
Translation

Occurs in the 2. ______


DNA is used to create 3.
______

Process by which
information encoded in
mRNA is used to assemble
a chain of 4. ______
at a ribosome
Occurs in the 5. ______
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. ______


DNA is used to create 3.
______

Process by which
information encoded in
mRNA is used to assemble
a chain of 4. ______
at a ribosome
Occurs in the 5. ______
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. Nucleus


DNA is used to create 3.
______

Process by which
information encoded in
mRNA is used to assemble
a chain of 4. ______
at a ribosome
Occurs in the 5. ______
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. Nucleus


DNA is used to create 3.
mRNA

Process by which
information encoded in
mRNA is used to assemble
a chain of 4. ______
at a ribosome
Occurs in the 5. ______
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. Nucleus


DNA is used to create 3.
mRNA

Process by which
information encoded in
mRNA is used to assemble
a chain of 4.amino acids
at a ribosome
Occurs in the 5. ______
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. Nucleus


DNA is used to create 3.
mRNA

Process by which
information encoded in
mRNA is used to assemble
a chain of 4.amino acids
at a ribosome
Occurs in the 5. cytoplasm
mRNA is used to create 6.
______
Transcription vs. Translation Review
On your Check Point Paper, answer the following
blanks:
Transcription


Process by which genetic
information encoded in
1.DNA is copied onto
messenger RNA
Translation

Occurs in the 2. Nucleus


DNA is used to create 3.
mRNA

Process by which
information encoded in
mRNA is used to assemble
a chain of 4.amino acids
at a ribosome
Occurs in the 5. cytoplasm
mRNA is used to create 6.
proteins
How to read a Codon Chart
Two kinds:
Square table
Round Chart
How to Read a Codon Chart/Table



Using the Codon
AUG (start codon)
Locate the first
letter of your
codon using the
left side of the
table.
Look for the A
Codon: AUG



The second letter
of your codon is ‘U’
Look at the top of
the table where
you see the title
‘2nd letter’
Find the letter ‘U’
and follow it down
until it intersects
with the letter ‘A’.
Codon: AUG



Look to the right for
the third letter, “G”
Move your finger
from the ‘G’ on the
left over to the left
and you should land
on ….. Methionine
(start codon)
Yes you did it! Now,
try another codon
Try the codon CAC –
Write your Answer on your sheet
Try the codon CAC –
Answer:
Histidine
Write your Answer on your sheet