Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Using the Genetic Code Objective: Translate DNA codes to amino acid sequences of proteins. Reminder: * When transcribing the code into RNA, A in DNA goes with U in RNA, and T in DNA goes with A in RNA * The amino acids in the genetic code match the mRNA codons (not the anti-codons!). * The message is between the Start and Stop codons only! Part I: Going Step by Step Template Non-Template AACTACTTACC T TATACGATCTTTA TTGATGAATGGAATATGCTAGAAAT 1. Write the template DNA strand: _____________________________________________________ 2. Transcribe to mRNA: _________________________________________________ 3. Divide into codons: _____ _____ _____ _____ _____ _____ _____ _____ _____ 4. List the tRNA anticodons: (Not to be used in step 5!)_____ _____ _____ _____ _____ _____ _____ _____ _____ 5. Write the amino acid sequence of the protein, using the genetic code, and the CODONS of the mRNA: _______________________________________________ Notes: * Start = AUG. * Amino-acids: Use the first 3 letters. (Methionine = Met) 6. Check yourself: The first letters of the amino acids you put together make up a word. The word is: _______________________ Part II: Practice Skipping steps 1 and 4, repeat the process with the following DNA template strands: 1. AATCTACAGACGCGACTAGCAACGGATTCCC 2. TTCTACCGCTACTAGACATAATCAGGGTAGAGACTAACT 3. CGGTTACTCATACCTAAATTTTATTCCGTGCC Written by: Michal Danin-Kreiselman, Ph.D.