* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Message Conversion Activity
Metalloprotein wikipedia , lookup
Genomic library wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
DNA profiling wikipedia , lookup
Amino acid synthesis wikipedia , lookup
SNP genotyping wikipedia , lookup
Personalized medicine wikipedia , lookup
Gene expression wikipedia , lookup
Community fingerprinting wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Molecular cloning wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Messenger RNA wikipedia , lookup
Point mutation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
“DNA Message Conversion Activity” ATGCATGGTACCTATGATGACCTGCAGTACTAATTGCGTTGTCTT TAATTGAGTACGTATCTTTTAACGCTCAAGCATGCTTACGCT CCACTCATGCTTGCA What is all of that gibberish? That jumble of letters actually represents a secret message encoded by DNA. A message that you as a student will definitely be pleased to decode! This will teach you how to use the genetic code, gaining "hands-on" experience and seeing how a sequence of DNA bases translates into a finished, meaningful product in the form of a protein (message). DNA » mRNA » tRNA » amino acid » protein In order to reap the benefits of this "secret message," you must be able to use a genetic code chart to decode the DNA sequence. You should separate the message into codons (Three Nitrogen Bases) and match those codons with their corresponding mRNA sequences in the genetic code chart below. You should notice that the last nucleotide of some DNA codons can vary. The letters j, v, q, h, x, and z are not coded because they are not in the secret message. Genetic Code Chart Letter A R P N B D C E I O Amino Acid ala arg gln asn gly asp cys glu ile val mRNA GCA CGA CAA AAC GGU GAC UGC GAA AUA GUA C G G U G U C A U U G C U C U G Letter L K M F G U S T W Y Amino Acid leu lys met phe his pro ser thr trp tyr mRNA CUA AAA AUG UUC CAU CCA UCA ACA UGG UAC G G U C G C C U G G C U U U U