* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Worksheet 6 - Iowa State University
History of genetic engineering wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transposable element wikipedia , lookup
Human genome wikipedia , lookup
Hammerhead ribozyme wikipedia , lookup
Molecular cloning wikipedia , lookup
Microevolution wikipedia , lookup
Genetic code wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenomics wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Long non-coding RNA wikipedia , lookup
RNA interference wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Transcription factor wikipedia , lookup
Messenger RNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding DNA wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
DNA polymerase wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
History of RNA biology wikipedia , lookup
Worksheet 6 Supplemental Instruction Iowa State University Leader: Course: Instructor: Date: Laura Bio 313 Dr. Rodermel 9/22/15 WARM-UP: Diagram Rolling-circle replication and show all the possible outcomes: 1. What kind of RNA is transcribed by the following polymerases? a. RNA polymerase I b. RNA polymerase II c. RNA polymerase III 2. Draw the DNA Template with RNA being transcribed, be sure to include the Tx Bubble, direction of synthesis, template and nontemplate strand 3. What is the PURPOSE of Initiation, Elongation, and Termination? a. Initiation b. Elongation c. Termination 1060 Hixson-Lied Student Success Center 515-294-6624 [email protected] http://www.si.iastate.edu 4. How does sigma recognize the promoter? Can sigma always bind to the promoter? 5. What roll does conformational changes play in transcription? Why are they important? 6. How is the process of transcription similar and/or different between Prokaryotes and Eukaryotes? CHALLENGE QUESTIONS: 7. The following DNA nucleotides are found near the end of a bacterial transcription unit. 3’ – AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA – 5’ a. Mark the point at which transcription will terminate b. Is this terminator Rho dependent or Rho independent c. Draw a diagram of the RNA that will be transcribed from this DNA, including it’s nucleotide sequence and any secondary structure. 8. Suppose that the string of A nucleotides following the inverted repeat in a rhoindependent terminator were deleted but that the inverted repeat was left intact. How will this deletion affect termination? What will happen when RNA polymerase reaches this region?