Download Worksheet 6 - Iowa State University

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

History of genetic engineering wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Transposable element wikipedia , lookup

Human genome wikipedia , lookup

Hammerhead ribozyme wikipedia , lookup

DNA wikipedia , lookup

Molecular cloning wikipedia , lookup

Microevolution wikipedia , lookup

Nucleosome wikipedia , lookup

Genetic code wikipedia , lookup

Telomere wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Epigenomics wikipedia , lookup

Genomics wikipedia , lookup

Point mutation wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA supercoil wikipedia , lookup

Long non-coding RNA wikipedia , lookup

RNA interference wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Transcription factor wikipedia , lookup

Gene wikipedia , lookup

Messenger RNA wikipedia , lookup

Epigenetics of human development wikipedia , lookup

Non-coding DNA wikipedia , lookup

Short interspersed nuclear elements (SINEs) wikipedia , lookup

DNA polymerase wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

RNA world wikipedia , lookup

RNA silencing wikipedia , lookup

Polyadenylation wikipedia , lookup

Replisome wikipedia , lookup

Epitranscriptome wikipedia , lookup

RNA-Seq wikipedia , lookup

RNA wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

History of RNA biology wikipedia , lookup

Non-coding RNA wikipedia , lookup

Primary transcript wikipedia , lookup

Transcript
Worksheet 6
Supplemental Instruction
Iowa State University
Leader:
Course:
Instructor:
Date:
Laura
Bio 313
Dr. Rodermel
9/22/15
WARM-UP:
Diagram Rolling-circle replication and show all the possible outcomes:
1. What kind of RNA is transcribed by the following polymerases?
a. RNA polymerase I
b. RNA polymerase II
c. RNA polymerase III
2. Draw the DNA Template with RNA being transcribed, be sure to include the Tx Bubble,
direction of synthesis, template and nontemplate strand
3. What is the PURPOSE of Initiation, Elongation, and Termination?
a. Initiation
b. Elongation
c. Termination
1060 Hixson-Lied Student Success Center  515-294-6624  [email protected]  http://www.si.iastate.edu
4. How does sigma recognize the promoter? Can sigma always bind to the promoter?
5. What roll does conformational changes play in transcription? Why are they important?
6. How is the process of transcription similar and/or different between Prokaryotes and
Eukaryotes?
CHALLENGE QUESTIONS:
7. The following DNA nucleotides are found near the end of a bacterial transcription unit.
3’ – AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA – 5’
a. Mark the point at which transcription will terminate
b. Is this terminator Rho dependent or Rho independent
c. Draw a diagram of the RNA that will be transcribed from this DNA, including it’s
nucleotide sequence and any secondary structure.
8. Suppose that the string of A nucleotides following the inverted repeat in a rhoindependent terminator were deleted but that the inverted repeat was left intact. How will
this deletion affect termination? What will happen when RNA polymerase reaches this
region?