* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Nucleotide Sequence and Organization of the Rat Heme Oxygenase
Gene expression profiling wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Pathogenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Gene therapy wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding RNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Gene desert wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Genome evolution wikipedia , lookup
Human genome wikipedia , lookup
Molecular cloning wikipedia , lookup
Transposable element wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Transcription factor wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
SNP genotyping wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epigenomics wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Metagenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genomic library wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Microevolution wikipedia , lookup
Designer baby wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Point mutation wikipedia , lookup
Genome editing wikipedia , lookup
Primary transcript wikipedia , lookup
Helitron (biology) wikipedia , lookup
THEJOURNAL OF BIOLOGICAL Vol. 262, No. 14,Issue of May 15, pp. 6795-6802 1987 Printed in CIT.S.A. CHEMISTRY 0 1987 by The American Society of Biological Chemists, Inc Nucleotide Sequence and Organization of the Rat Heme Oxygenase Gene* (Received for publication, September 8,1986, andin revised form, January 8,1987) Rita M.Muller, Hayao TaguchiS, and Shigeki Shibaharas From the Friedrich Miescher-Institut, CH-4002 Basel, Switzerland The microsomal heme oxygenase cleavesthe heme ring at the a-methene bridge to form biliverdin, a tetrapyrrole green pigment (1).Biliverdin is subsequently converted to bilirubin, a yellow bile pigment, by biliverdin reductase (2). Under physiolo~calconditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed (3). Heme oxygenase activity is highly inducible by its substrate heme (3-7) and by various non-heme substances such as heavy metals (8,9), bromobenzene (lo), and endotoxin (11){reviewedin Ref. 12). We are particularly interested in the induction of heme oxygenase by its substrateheme because 1)heme is an essential component of hemoglobin and other hemoproteins, and is required in all animals cells, 2) hemin appears to induce heme oxygenase at the transcriptional level (13-15), and 3) hemin also regulates the activity of S-aminolevulinate synthase, a key enzyme for heme biosynthesis (reviewed in Ref. 16). Thus, heme seems to regulate both its biosynthesis and degradation. Heme also regulates the transcription of yeast - * The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s)reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank withaccessionnumberfs) 502722. $ Present address: Dept. of Agricultural Chemistry, The University of Tokyo, Tokyo 113, Japan. $ To whom correspondence should be sent: Friedrich MiescherInstitut, P. 0. Box 2543, CH-4002 Basel, Switzerland. by in situ plaque hybridization (20). The hybridization probes used were an equimolar mixture of the EcoRI-EcoRI fragment (nucleotide residues -101-88) and theEcoRI-HindIII fragment (nucleotide residues 88-971) excised from the rat heme oxygenase cDNA, XRHO6 (E), andlabeled with [(r-32P]dCTPby random priming method (21). The numbers in parentheses, shown together with restriction enzymes, indicate the 5”terminal nucleotide generated by cleavage. Hybridization-positive phage clones were isolated by repeated plaque purification, and the isolated DNA inserts were subcloned in pUC8 plasmid (22). The subcloned DNA fragments were used for further analysis, and nucleotide sequences were determined (23). SI ~ ~ ~ a s e - ~Analysis-Total p i n g RNA was isolated from rat spleen (24) for S1-mapping analysis, as spleen is abundant in heme oxygenase mRNA (15, 25). The EcoRI-BamHI DNA fragment (nucleotide residues -749-372) was partially digested with XhoI. The obtained EcoRI-XhoI fragment (nucleotide residues -749-69) was labeled at its 5‘ ends with [y-3ZP]ATPusing T4 polynucleotide kinase and then digested with NdeI. The resulting NdeI-XhoI fragment (nucleotide residues -139-69) (20 fmol) was hybridized with spleen RNA (20 pg) a t 45 ‘C for 3 h in 10 pl of 80% formamide containing 0.4 M NaCl, 1m M EDTA, and 40 mM Pipes,’ pH 6.4 (26), and digested with S1 nuclease (180 units/ml) a t 37 “C for 30 min. The products were fractionated by electrophoresis on a sequencing gel. Analysis of Promoter Function of the 5 ’ - F ~ n kRegion-The ~~ EcoRI-BamHI fragment (nucleotide residues -748-373)was transcribed in the presence of [C~-~’P]GTP using HeLa cell lysates according to the instru~ions of the supplier. The concentrations of template DNA and a-amanitin was 12 pg/ml and 1 pg/ml, respectively. The products of in vitro transcription were analyzed as described (27). We also used the subcloned plasmid harboring the EcoRI-EcoRI fragment (nucleotide residues -748-2116) as a template and determined the 5‘ end of the transcriptsby S1 nuclease-mapping analysis. The S1probe was the HindIII-BamHI fragment (nucleotide residues -549-373) end-labeled at theBamHI site. The abbreviations used are: Pipes, 1,4-piper~inediethanesulfonic acid; kb, kilobase pairs; bp, base pairs. 6795 Downloaded from www.jbc.org by on December 1, 2006 Heme oxygenase, an essential enzyme of heme catab-iso-l-cytochrome c gene (17). In order to understand the molecular mechanisms of inducolism, is inducibleby its substrate heme, by heavy metals, and by various other substances.To study the tion of heme oxygenase, we have isolated and characterized molecular mechanisms of the induction of heme oxy- the genomic clones for rat heme oxygenase. We show the genase, we isolated the heme oxygenase gene from a complete nucleotide sequence of the heme oxygenase gene rat genomic DNA library using cloned cDNA as hy- and its 5“flanking region. bridization probes and determined its complete nucleoEXPERIMENTAL PROCEDURES tide sequence. The gene is composed of 6830 nucleotides, and is organized in four introns andfive exons. Materials-Sprague-Dawley rats were used as sources of DNA and The transcription initiation site was identified by S1 RNA. Restriction endonucleases were purchased from Bethesda Renuclease mappinganalysis. Using HeLa cell lysate, we search Laboratories, New England BioLab, and Pharmacia; bactericonfirmed that the transcription of cloned hemeoxy- ophage lambda packaging kits and DNA of EMBL4 from Amersham genase gene is initiated accurately at the assignedini- Corp.; DNA polymerase I (Klenow fragment), T4 pol~ucleotide tiation site. In the 5”flanking region of the heme ox- kinase, DNA ligase and nuclease S1 from Phannacia; HeLa cell lysate ygenase gene, we foundseveral potential bindingsites from Bethesda Research Laboratories; [(u-~*P]~CTP and [y3*P]ATP Amersham Corp. for different transcription factors: a transcription fac- from Ctoning and Sequencing of Genomic DNA Encoding Rat Heme tor Spl, a positive regulator for the controlof amino Oxygenase-A genomic DNAlibrary, constructed using EcoRI partial acid synthesis (GCN4), a heat shock transcription fac- digests of Sprague-Dawley rat liver DNA, was kindly provided by Dr. tor, and a metal-dependent transcription factor. Fur- J. Bonner, Phytogen, Pasadena, CA (18). We also constructed our l containsthesequencethat thermore,theintron own rat genomic DNA library in EMBL4, a lambda replacement shows about 65% homology to that of the neuronal vector (IS), using Sau3AI partial digests of rat liver DNA. These libraries were screened for DNA segments encoding heme oxygenase identifier sequence, a possible enhancer element. 6796 Structure of the Heme Oxygenase Gene RESULTS AND DISCUSSION A. 5, a = a . - o z p.":zU"p 31 t a " I = i a S a 3 1 0 f B EXON3 EXON2 EXON1 1Kb J II H EX0115 EXON4 .IRH~I c 0. -1000 -1 I 1000 1 H E C R E Z HN I XXABA GX 2000 R 4WO 3000 GYASERUDTMPPJOJR RIA UPWAAP IN I I I I 54 I C - c O H - EXON 1 rn " U R ID S DRQ EXON2 - " " " " u c I P _ A EXON5 --- "cc Y ccc 4 G 3 ' P J " " " " - H W S H F L EXON4 " " " " v 1000 I I I1 EXON3 u "" " ""ccc ccc eo00 5000 CI " CI " FIG. 1. Restriction map and sequencing strategyof cloned rat genomicDNA encoding heme oxygenase.The direction of transcription is from left to right. A, restriction map of cloned rat heme oxygenase gene.All existing sites for restriction enzymes indicated are shown, except for the region contained inthe 3'-EcoRI fragment (about 8 kb) of XRHO1. The locations of exons are indicated by open boxes (untranslated regions) and by closed boxes (protein coding region). B, sequencing strategy. The arrows indicate the direction and extent of sequence determinations. The short uertical lines at the end of arrows indicate the sites of 5' end labeling. The restriction sites used for 5' end labeling were abbreviated as follows: A , AuaII; B , BamHI; C, AccI; D,DdeI; E, EcoRI; F, FnulHI; G, BglII; H , HindIII; I,H i n f f J , BanII; L, ClaI; M , SmaI; N , NdeI; 0,NcoI; P, PuuII; Q, TaqI; R, RsaI; S , PstI; T , BstNI; U, AluI; W, SstI; X , XhoI; Y, XbaI; 2,HpaII. A slashed box indicates the NdeI-XhoI fragment labeled at theXhoI site, which was used for S 1 nuclease-mapping analysis (see Fig. 3 ) . Downloaded from www.jbc.org by on December 1, 2006 Isolation of Rat Genomic DNAEncoding Heme OxygenaseThe rat genomic library used initially was a collection of recombinant phage that contain rat liver DNA fragments generated by partial digestion with EcoRI and joined to theX Charon 4A arms (18). From about 1.5 x lo6 plaques, we isolated and characterized one hybridization-positive clone (XRHOl). XRHOl harbors a DNA insert composed of two EcoRI fragments of about 7 kb and 8 kb in the 5' to 3' direction (Fig. lA). Restriction mapping and blot hybridization analysis indicated that the DNA fragment carried by XRHOl does not contain the 5' upstream region from the internal EcoRI site of rat cDNA (15). Therefore, using an EcoRI-EcoRI fragment (nucleotide residues -101-88) excised from a cDNA clone, XRHO6 (15), we screened the same library (about 2 X lo6 plaques), but we could not isolate the phage clone carrying 5' upstream region. Therefore, we decided to construct our own library using Sau3AI partial digests of rat liver DNA. From 1 X lo6 plaques, we isolated four positive clones using a same EcoRI-EcoRI probe. One of them, XRH05, carries a DNA fragment encoding the 5' upstream region. The clone, XRH05, harbors a DNA insert composed of 5 EcoRI fragments of about 400,900, and 500 bp, and 2.8, 7, and 3.9 kb in the 5' to 3' direction (Fig. lA). The DNA fragment carried by both overlapping genomic clones, XRHOl and XRH05, encoded the entire region of heme oxygenase gene (Fig. lA). Blot hybridization analysis of rat liver DNA indicated that the cloned heme oxygenase gene retains the same sequence organization asinthe genomicDNA and suggested that there is a single gene for heme oxygenase in rat genome (data not shown). deterStructure of theRat HemeOxygenaseGene-We mined the nucleotide sequence of the entire rat heme oxygen- ase gene and about 1.4 kb of the 5'-flanking region according to thestrategy shown (Fig. 1B). We determined the sequence in both directions. The ratheme oxygenase geneis composed of 6830 nucleotides and is divided by four introns into five exons (Fig. 2), which are identified by comparison with the cDNA sequence. To identify the transcription initiation site, we used S1 nuclease-mapping analysis. The S1 probe was the NdeI-XhI fragment (nucleotide residues -139-69) labeled at the X h I site and is indicated by a sloshed box in Fig. 1B. The results show the presence of several protected fragments aroundone major fragment (Fig. 3), suggesting that the transcription of the heme oxygenase genestarts atone main site. By comparing the position of the major protected fragment with sequence ladder of the S1 probe, we assign the A residue of nucleotide 1 as the tentative transcription initiation site (indicated by an arrow in Fig. 3). In this analysis, we assume that the mobility of the protected fragment is about 1 residue behind that of the products in the sequence ladder (28). The A residue of nucleotide 1 is also the first nucleotide of the full length cDNA, pRHOl (15),andthereare no plausible acceptor sequences of intron near this A residue. Therefore, we conclude that thetranscription starts mainly at theA residue of nucleotide 1. The lengths of five exons are 151,121,492,100, and 693 bp in the 5' to 3' direction. Promoter Activity of 5'-Flanking Region of the Rat Heme Oxygenase Gene-There are no typical TATA-boxes (29) and CAAT-boxes (30) in the 5"flanking region of the heme oxygenase gene. However,one TATA-like sequence, TACTTAA, is located 28 bp upstream from the transcription initiation site (Fig. 2). The promoter function of this TATA-like sequence was analyzed using HeLa cell lysate (Fig. 4). The transcription of the truncated DNA fragment containing a TATA-like sequence gave rise to the product of about 390 6797 ~ t r ~ ~ofuthe r eHeme Oxygenase Gene -1321 A~GCTTG~TTCTA~TfTCCAAAAT6lT~6A6llGGlTlllCT66AGA~lClCAGG~lTAACAAAACA -1201 ~~GACACAAAAAGTGRA6TC~llGlT6A6AlCbAAAGlCA~lllAGA6lAG6AGAGAl6G~C66Gl66TlCACA6l~Cll~ClGCCClTACA6A66ACCT~AATTCAGllCCClACAT66 120 ACA6TC6CCAGTC6CCTECA6AGlllCC6CClCCAbCCA6C6R6l66A6CCl6CC66~GCA6A6CCAlCTC6~GC6GA6CCC66ffiCCl6AA6CG~6C66~6CCA6CCT6AACl~6CCCA -Exon 1 210 6TCCC6C6~6A6C6CCCACA6CTC6RCA66CAA6C6~ClRCll6G66AC666~~Cl6l6Al6TCCC6C6lCCCTl6lCCA6CClA6AA~l6CA66Cl6C666ACCAA66bAC6A6ll6 I Intron 1 3b0 CC6CCCA6TCTRCCTGTAGCCRl6G6CA6CT66R6G6A6A~bRl6lGAlTC~CCCClCl6ACAC6Cl66A66l6ACC66Al6G6l6l6lCll6lAGlAlCCR66Tll6R6GGAl6bACA6 Downloaded from www.jbc.org by on December 1, 2006 -241 ~GdCTTG6GGCCC6G~TGGG~CbdlCCCTGG6TlTGCCC~~CA6CAlCTCACbGClAGAR~lGTClCCTAGTlCT66AAC~TlCCA6AlTCCl6A6A66C~66ClAClCCT6CClTCCTA 7-20 6TA6~TCAA6TT66CCTTGAACTCC86TTCGCTTCCCTll6CTTCCl6A6lACl6A6AlT6AA66l6CCCC6CCbCCACbCll66CllCl~llC&lCClCClCCTCClCClCClCCllCl 840 - CCTCTTCCTCCT~~TCCTCTTCCTCT~CllCCTCCllClCClCllCCTCClTClCClClTl6AlllTTlll6bGAC66A6CGCClClTl6lA6CCCl6GAl~lCTlCAClCl6lAGAlCA 960 66CT66CCTA6~ACTC66~6ATCT6CCTGCCTCl6CClCCClAGl6Cl6AGAllACA66CCT6CACCAClCl6lCCAGClClTlTllClllll~TCCllTlRlAAAGCC~~lTll~T~~l . 1080 TAT~TTTTT~TTf~~A6C6TCTCG~6l~AC~llTA~lllbTCGl6CAT6lAGA6TG6CCACAlAlAl6ACACAClAA~lAl6l66AGGTC~6AGllCGAClTG~AGAAA6TCACllCTCA 1200 6TCT~CC~f6TG6CTTCCA~G~AA6AT~66Cl?ATCA6GT66CAA6lGC6TllCCl66Cl6A6CTlACACT6lCTAGlCClCACCTC~~~C~Tll~6CA6~~~G6~l~~~~C?T~~~~~T FIG.2. Nucleotide sequence of the rat heme oxygenase gene. The nucleotide sequence of the message strand is shown. Nucleotide residues are numbered in the 5' to 3' direction, beginning with the transcription initiation site,and thenucleotides on the 5' side of residue 1are indicated by negative numbers. Exons are indicated by thick solid lines. The transcription initiation site is marked with an asterisk. The ATG codon for initiating methionine and the TAA termination codon are indicated by an owrline. A TATA-like sequence is indicated by ouerline and underline. The potential binding sites for different transcription factors areindicated as follows: Spl, solid lines;GCN4, dotted lines; beat shock t r a n ~ ~ p t i factor, o n double u ~ r l i n e sand ; me^-dependent transcription factor, double dotted lines. Four copies of Alu-type sequences are indicated by thin underlines. The identifier-like sequence was indicated by an ouerline. The direct repeatscomposed of 42 pyrimidines are indicated by underlines with an arrowhead. 6798 Downloaded from www.jbc.org by on December 1, 2006 . 3360 . 3840 . 3960 66T66CCC~C6C~T~T~CCC6Cl~CCT666l6ACClClC~66666lCA66lCCl6~~6A~6~ll6C6C~6A~66CC~l66CCll6CC~~6ClCl6666~~66CCl66CllllTlC~CCll CCT6T666~66~6TG~T~CA6666~A6llCCCl6Al6lC~ll6ClClCll6l6l66l666Cl6l6AlCClCl6RC~~l66l6lA6Cl66ACCl6666l6CCl6~6l~Cl66l6C~l66CC A66CCA6CI\CA6TCCA66CllC66~T6Cl6AC~l6lCCC~66l66CRTlT6CllCClTTTClTT6~TTT6CRTT6RT6T6TT6CCCRC666T~T~TCT6TlT66T6TC~6ATTC6ll666 . 4080 66T66~6CTACA6AC~6CT666~6CT6CC~CAG666~~CC666~~Tl6~ACCC6CAlCClCl66~6~6C~AClA~C6ClCllA~lClll6~~ClAlCTll~6ClC66l6llll6~6C~~6 , 4200 6CCCCG~AA66C~6~6CT66666~6l~6~Cl6lCCl~lll~l~Cl~l666l6Cl~l66l66TC~666llCC~~lll666ACClCCl6lClClCCCCAClllC~6CCl6A6~6CCllT~~~ FIG. 2"Continued 6799 Downloaded from www.jbc.org by on December 1, 2006 FIG. 2-Continued 6800 Structure of Oxygenase the Gene Heme A C T significance. Three copies of GGGCGG, a basic motif of the binding site for Spl (reviewed in Ref. 31), are located at G A C C T 1 2 positions (-520) to (-526), (-99) to (-91) and (-58) to (-52). The first of these three is in a 3’ to 5’ orientation. The second sequence,GGGGCGGGG,is completely identical with the consensus sequences of Spl binding sites (33). Two copiesof TGACTC are located at positions (-138) to (-143) and (-43) to (-38). The first copyis in a 3‘ to 5’ orientation. This hexanucleotide is the binding site for the transcriptionfactor GCN4, which is responsible for general amino acid control regulation in yeast (reviewed in Ref.32). In yeast, many different amino acid biosynthetic pathways are under a comG mon control and activated in response to starvation for any C single amino acid. Furthermore, a sequence with an almost G perfect dyad symmetry, TCTGGAACCTTCCAGA, islocated A 273 bpupstream from the transcription initiationsite (double G underlines in Fig. 2) and is completely identical to the con-T sensus sequence of heat shock element, C--GAA--TTC--G, G which can bind the heat shock transcription factor, a posiT tive regulator of the transcription of the heat shock proC tein genes (reviewed in Ref. 33). The regulatory region also A contains a sequence with an imperfect dyad symmetry, GGGTGCTGCACTC (nucleotide residues -581 to -569), which contains two copies of core sequences of metal regulatory elements found in metallothionein genes (34). However, the heme oxygenase gene contains no heme-responsive element of the yeast iso-1-cytochrome c gene (17). We are particularly interested in the presence of a heat shock element because of the similarities in the natureof the induction of heat shock proteins and of heme oxygenase.Like heme oxygenase, heat shock proteins are induced by various reagents or conditions (reviewed in Ref. 35), which seem to be stressful for the cells or tissues. Recently, we found that both activity and mRNA of heme oxygenaseincreased following heat-treatment of rat glioma cells? Features of Intron Sequences-The lengths of four introns are 1900, 826, 1508,and 1039 bp in the 5‘ to 3’ direction. All FIG. 3. S1 nuclease-mappinganalysis of the 5’ end of heme the exon/intron boundaries follow the GT/AG rule (36) and oxygenase mRNA. The S1 probe was hybridizedto spleen RNA or are consistent with the consensus sequences for donor and yeast tRNA, digestedwith S1 nuclease, and fractionatedon a sequenc- acceptor sites of RNA splicing (37), with the exception of the ing gel together with the sequencing ladder of the S1 probe (NdeI- donor site of the intron 1 (Fig. 2). The intron 1begins with a XhoI fragment labeledat the XhoI site, see Fig. 1B).Complementary GC dinucleotide instead of a GT dinucleotide. To exclude the nucleotides aroundthe initiation sites are shownalong the sequencing possibility of sequencing error, we confirmed this donor seladder. The predominant transcriptionsite is indicated by an arrow. Lane I, the protected fragmentswith spleen RNA, andlane 2, control quence several times using different subclones. Interestingly, the same deviation of donor sequences was reported in four sample with yeast tRNA. other examples: chick (38) and duck aD-globin genes (39), murine a*-crystallin gene (40) and human y subunit prenucleotides (indicated by an arrow in Fig. 4 4 , Lane a), which cursor gene of muscle acetylcholine receptor (41). In all these was not detectable in the presence of a-amanitin (lane b). cases, the deviated donor sequences have a common sequence, The size of this product by RNA polymerase I1 is consistent AG/GCAAGwhich is similar to the consensus sequences with the expected size of the transcripts (376 nucleotides). except for the C residue. In the case of duck aD-globingene, Then, we used subcloned plasmid as a template and deter- the deviated donor sequence of the intron was functional in a mined the 5’ end of the RNAs synthesized in vitro by S1 transient expression system (39). Therefore, the AG/GCAAG is a functional donor sequence of some introns. Like the nuclease-mapping analysis (Fig. 4B). The S1 probe was the murine aA2-crystallin gene (40), a possibility of an alternative HindIII-BarnHI fragment (nucleotide residues -549-373) lasplicing for heme oxygenase mRNA not is excluded, although beled at the BarnHI site, which is located in the intron 1. The the resulting truncated polypeptide is only 17-amino acid major protected band of about 390 nucleotides was sensitive residues due to thepresence of termination codon TGAin the to a-amanitin indicated by an arrow (Fig. 4B,lane a).Another intron 1 (nucleotide residues 180-182). Within the intron 1, strong signal of about 900 nucleotides was probably due to there areno open reading frames which start with a potential the presence of protected S1 probe, which was not digested initiating methionine and encode a long peptide. with S1 nuclease. Therefore, the transcription of the cloned In the rat heme oxygenase gene region, we found four copies heme oxygenase geneis initiated accurately and efficiently at of repeated sequences whichare similar (about 70%) to those or near the assigned transcription initiationsite. of rat Alu-like sequence (42). As underlined in Fig.2, one Features of 5’-Flanking Region- In the regulatory region copy is in the 5’-flanking region, nucleotide residues (-1067) of the rat heme oxygenase gene, we found several potential binding sites for known transcription factors of regulatory * S. Shibahara andR. M. Muller, manuscriptin preparation. + + + “\ Downloaded from www.jbc.org by on December 1, 2006 v 6801 Structure of the Heme Oxygenase Gene A FIG. 4. Promoter activity of 5’flanking regionof the rat hemeoxygenase gene.A, in uitro transcripts of truncated DNA template containing a putative TATA-like sequence. The EcoRI-BamHI fragment (nucleotide residues -748-373) was transcribed in the absence (lane a) or in the presence of aamanitin (lane b). The size markers were end-labeled bX174RFDNA fragments generated by the digestion with Hue111 and were given in base pairs (lane c). B, identification of the 5‘ end ofRNAs synthesized in uitro. The subcloned plasmid (40 pg/ml) was transcribed in the absence (lane a) or in the presence of aamanitin (lane b), and the products were analyzed by S1 nuclease mapping. The size markers (lane c) were same as in A. B a b c a b c 18% 872 603 . ) 310 271/ 281 234 310 271/281 194 194 118 118 234 1184 GGArrGAACTTAGGACTTCAAACATTCTAGGCAAGCGCTTTACCCATAAGGTA~GTAT~G~CC1249 1181 GGACCGAACCCAGGGCCUUGCGCUUCCUAGGCAAGCGCUCGCUAAAUCCCCAGCCCC 1116 ** *I **+* ** * +**+ + FIG. 5. Homology between the intron1of the heme oxygenase geneand the rat identifier sequence. The top line shows the sequence of the intron 1 (nucleotide residues 1184-1249) and the bottom line shows the complementary strand of identifier sequence (nucleotide residues 1181-1116) of clone plB308 (44). Asterisks indicate nucleotide differences. 1) REFERENCES S., and Schmid, R. (1969) J. Bwl. Chem. 244,6388-6394 2. Tenhunen, R., Ross, M. E., Marver, H. S., and Schmid, R. (1970) the heme oxygenase gene contains the sequence (nucleotide Biochemistry 9,298-303 residues 1184-1249) that shows about 65% homology to the 3. Tenhunen, R., Marver, H. S., and Schmid, R. (1970)J. Lab. Clin. complementary strand of the neuronal identifier sequences Med. 75,410-421 (43, 44) (Fig. 5). The identifier sequence, a middle-repetitive 4. Pimstone, N. R., Engel, P., Tenhunen, R., Seitz, P. T., Marver, element, is located preferentiallyin introns of neuronal-speH. S., and Schmid, R. (1971) J. Clin. Inuest. 50. 2042-2050 as a positive regulator 5. Pimstone, N. R., Tenhunen, R., Seitz, P. T., Maker, H. S., and cific genes (44)and recently is proposed Schmid, R. (1971) J. Exp. Med. 133, 1264-1281 of neuronal-specific gene expression (45). The intron 1 also 6. Gemsa, D., Woo, C. H., Fudenberg, H. H., and Schmid, R. (1973) contains incomplete direct repeats of 42 bp, which are comJ. Clin. Inuest. 52, 812-822 posed only of pyrimidines (indicatedby the underline with a n 7. Shibahara, S., Yoshida, T.,and Kikuchi, G. (1978) Arch. Biochem. arrowhead in Fig. 2). Incidentally, these direct repeats show Biophys. 188,243-250 of protein about 66%homology to the complementary strand 8. Maines, M. D., and Kappas, A. (1974) Proc. Natl. Acad. Sci. U. S. A. 71,4293-4297 coding region of yeast heat shock protein-90 gene (nucleotide 9. Maines, M. D., and Kappas, A. (1976) Biochem.J. 154,125-131 residues 707-632) (46). 10. Guzelian, P. S., and Elshourbagy, N. A. (1979) Arch. Biochem. The heme oxygenase gene and its 5”flanking region conBiophys. 196,178-185 tains a number of sequences of potential regulatory signifi11. Bissell, D.M., and Hammaker, L. E.(1976)Arch.Biochem. cance. Particularly, the presenceof a heat shock element led Biophy~.176,91-102 us to find that hemeoxygenase is a heat shock protein.2 The 12. Kikuchi, G., and Yoshida, T. (1983) Mol. Cell. Biochem. 53/54, 163-183 structural and functional analysis will allow us to identify the 13. Shibahara, S., Yoshida, T.,and Kikuchi, G. (1979) Arch. Biochem. essential sequences forthe inductionof heme oxygenase. Our Biophys. 197,607-617 findingmay provide a new insight into the physiological 14. Ishizawa, S., Yoshida.. T.,. and Kikuchi.. G. (1983) . . J. Bwl. Chem. significance of heme catabolism. 258,4220-4225 15. Shibahara, S., Muller, R., Taguchi, H., and Yoshida, T. (1985) Proc. Natl. Acad. Sci. U.S. A. 82. 7865-7869 Acknowledgments-We thank T. D. Sergent, R. B. Wallace, and J. Bonner forthe gift of a rat genomic DNA library and M. Schnurren- 16. Kikuchi, G., and Hayashi, N. (1981) Mol. Cell. Biochem. 37, 2741 berger for herassistance in preparingthe manuscript. We also thank M. S. Altus, J. P. Jost, and Y. Nagamine for their helpful comments 17. Guarente, L.,and Mason, T. (1983) Cell 32,1279-1286 18. Sargent, T. D.,Wu, J-R., Sala-Trepat, J. M.,Wallace, R. B., and critical readingof the manuscript. to (-919); two copies are in the intron 1, nucleotide residues 780-908 and 1645-1795; and one copy is in the intron 3, nucleotide residues 4312-4437. Furthermore, the intron 1 of 1. Tenhunen, R., Marver,H. Downloaded from www.jbc.org by on December 1, 2006 72 6802 Structure of the Heme Oxygenase Gene Reyes, A. A., and Bonner, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,3256-3260 19. Frischauf, A. M., Lehrach, H., Poustka, A., and Murray, N. (1983) J.Mol. Biol. 170, 827-842 34. 20. Benton, W. D., and Davis, R. W. (1977) Science 196,180-182 21. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochern. 132, 36. 6-13 22. Frischauf, A. M., Garoff, H., and Lehrach, H. (1980) Nucleic Acids Res. 8,5541-5549 23. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 66, 499-560 24. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299 25. Shibahara, S., Yoshida, T., and Kikuchi, G. (1980) J. Biochern. (Tokyo) 88,45-50 26. Berk, A. J., and Sharp, P. A. (1977) Cell 12, 721-732 27. Tsujimoto, Y., Hirose, S., Tsuda, M., and Suzuki, Y. (1981)Proc. Natl. Acad. Sci. U. S. A. 78,4838-4842 28. Sollner-Webb, B., and Reeder, R. H.(1979) Cell 18,485-499 29. Breathnach, R., and Chambon, P. (1981) Annu. Reu. Biochern. 50,349-383 30. Benoist, C., O'Hare, K., Breathnach, R., and Chambon, P. (1980) Nucleic Acids Res. 8,127-142 31. Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends Biochern. Sci. 11,20-23 32. Fink, G. R. (1986) Cell 45, 155-156 33. Pelham, H.(1985) Trends Genet. 1, 31-35 Stuart, G. W., Searle, P. F., Palmiter, and R. D. (1985) Nature 317,828-831 35. Ashburner, M., and Bonner, J. J. (1979) Cell 17, 241-254 Breathnach, R., Benoist, C., O'Hare, K., Gannon, F., and Chambon, P. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,4853-4857 37. Mount,(1982) S. M. NucleicRes. Acids 10,459-472 38. Dodgson, J. B., and Engel, J. D. (1983) J.Biol. Chern. 258,46234629 39. Erbil, C., and Niessing, J. (1983) EMBO J. 2,1339-1343 40. King, C. R., and Piatigorsky, J. (1983) Cell 32, 707-712 41. Shibahara, S., Kubo, T., Perski, H. J., Takahashi, H.,Noda, M., and Numa, S. (1985) Eur. J. Biochern. 146,15-22 42. Alonso, A., Kuhn, B., and Fischer, J. (1983) Gene 26, 303-306 43. Sutcliffe, J. G., Milner, R. J., Bloom, F. E., and Lerner, R. A. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,4942-4946 44. Milner, R. J., Bloom, F. E., Lai, C., Lerner, R. A., and Sutcliffe, J. G. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 713-717 45. McKinnon, R. D.,Shinnick, T. M., and Sutcliffe, (1986) J. G. Proc. Natl. Acad. Sci. U. S. A. 83,3751-3755 46. Farrelly, F. W., and Finkelstein,B.D. (1984) J.Biol. Chern. 259, 5745-5751 Downloaded from www.jbc.org by on December 1, 2006