Download PASS MOCK EXAM

PASS MOCK EXAM – FOR PRACTICE ONLY –
Course: BIOL 1003 A
Facilitator: Zeke Williams
Dates and locations of mock exam take-up: 7:30-9pm Mon. Nov 9 [LA C164]; 6-7:30pm Wed. Nov 11 [ME 3380]
It is most beneficial to you to write this mock midterm UNDER EXAM CONDITIONS. This means:
• Complete the midterm in 50 mins.
• Work on your own.
• Keep your notes and textbook closed.
• Attempt every question.
After the time limit, go back over your work with a different colour or on a separate piece of paper and
try to do the questions you are unsure of. Record your ideas in the margins to remind yourself of what
you were thinking when you take it up at PASS.
The purpose of this mock exam is to give you practice answering questions in a timed setting and to
help you to gauge which aspects of the course content you know well and which are in need of further
development and review. Use this mock exam as a learning tool in preparing for the actual exam.
Please note:
•
Come to the PASS session with your mock exam complete. There, you can work with other
students to review your work.
•
Often, there is not enough time to review the entire exam in the PASS session. Decide which
questions you most want to review – the Facilitator may ask students to vote on which
questions they want to discuss.
•
Facilitators do not bring copies of the mock exam to the session. Please print out and complete
the exam before you attend.
• Facilitators do not produce or distribute an answer key for mock exams. Facilitators help
students to work together to compare and assess the answers they have. If you are not able to
attend the PASS session, you can work alone or with others in the class.
Good Luck writing the Mock Exam!!
DISCLAIMER: PASS handouts are designed as a study aid only for use in PASS workshops. Handouts may
contain errors, intentional or otherwise. It is up to the student to verify the information contained within. 1. What is the (typical) relationship between the light dependent and light independent reactions in photosynthesis. A) The light dependent reactions require light while the light independent reactions require darkness. B) The light independent reactions produce ATP and NADPH to drive the Calvin cycle. C) The light dependent reactions produce ATP and NADPH to drive photorespiration. D) The light dependent reactions produce ATP and NADPH to drive the Calvin cycle. E) The Calvin cycle produces ATP and NADPH to augment the light dependent reactions. 2. Which statement about photosystems I and II is correct? A) Chlorophyll a molecules of photosystem II split H20 to replace their electrons while the electrons lost by chlorophyll a in photosystem I get replaced by the electron transport chain. B) Reaction centre chlorophyll molecules of photosystem I best absorb light of 680nm wavelengths while the equivalent molecules of photosystem II best absorb light of 700nm C) Photosystem I passes electrons to the electron transport chain while photosystem II passes electrons to a short chain, then NADPH D) Photosystems I and II were discovered at different times but found to be exactly the same in structure and function. 3. What does the Calvin cycle use to regenerate RuBP? A) 9 ATP B) 9 ATP and 3 G3P molecules C) Rubisco D) 3 ATP and 5 G3P molecules E) 3 ATP, 5 G3P molecules and 6 NADPH 4. Fortunately, a product of photosynthesis is oxygen. Specifically, where does this oxygen come from? A) C02 B) H20 C) G3P D) Glucose E) Chlorophyll 5. A bundle sheath cell in _____ plants is where _____ occurs A) C4; Carbon fixation B) CAM; Carbon fixation C) C4; the Calvin cycle D) CAM; the Calvin cycle E) C3; the Calvin cycle 6. In Oswald Avery’s experiment a single sample of heat-­‐killed virulent bacteria and enzyme did not produce living virulent cells when introduced to a non-­‐virulent population. Which enzyme blocked the formation of virulent bacteria? A) RNase B) Protease C) Lipase D) DNase E) DNA Ligase 7. Chargaff’s first rule states, with regards to the relative percentages of nitrogenous bases in a sample of DNA… A) % Adenine = % Thymine & % Guanine = % Cytosine B) % Thymine = % Guanine & % Adenine = % Cytosine C) % Uracil = % Guanine & % Adenine = % Cytosine D) % Uracil = % Cytosine & %Adenine = % Guanine 8. Which statement about the packaging of DNA in a Eukaryotic cell is correct A) DNA is arranged in a circular chromosome. B) A double helix of DNA wraps around 8 histone proteins to form a nucleosome. C) A double helix of DNA wraps around 4 histone proteins to form a nucleosome. D) A super coil of DNA wraps around 8 histone proteins to form a nucleosome. E) A super coil of DNA wraps around 4 histone proteins to form a nucleosome. 9. Semi conservative DNA replication refers to… A) The division of a cell during telophase. B) Bi-­‐directional DNA replication from an origin of replication. C) The pairing of a single parent strand with a single daughter strand during the process of DNA replication. D) The pairing of a new daughter strand with an old daughter strand during DNA replication. E) The pairing of sister chromatids during mitosis. 10. How many and what kind of bonds connect i) Adenine to Thymine; ii) Guanine to Cytosine? A) 2; 3, all phosphodiester bonds. B) 3; 2, all hydrogen bonds. C) 3; 2, all phosphodiester bonds D) 1; 2, all phosphodiester bonds E) 2; 3, all hydrogen bonds 11. Which protein splits and re-­‐joins the strands of DNA, ahead of the replication fork, to prevent “overwinding” of the double helix? A) Helicase B) DNA Ligase C) Single-­‐strand binding protein D) Topoisomerase E) Overwindingcorrectomerase 12. Which of the following proteins can exonuclease along a DNA strand in both directions? A) DNA Polymerase I B) DNA Ligase C) DNA Polymerase III D) DNA Polymerase II E) Both A and C. 13. Following cytokinesis a cell contains a particular amount of DNA. At the end of which of the following phases will twice as much DNA be found in the cell? A) G0, S, G2 B) S, M C) S, G2 D) M, G2 E) M, S, G2 14. Two sister chromatids, connected at the ________, get pulled apart when spindles attach to their _______. A) Centromere; Kinetochores B) Kinetochore; Centromeres C) Centriole; Centrosomes D) Centrosomes; Centrioles E) Centrosomes; Kinetochores 15. In what stage of mitosis does i) the nucleolus disappear? ii) the nuclear envelope fragment? A) Prophase; Prometaphase B) Prophase; Prophase C) Prometaphase; Prometaphase D) Prometaphase, Metaphase E) Metaphase, Prometaphase. 16. The mitotic spindles begin to form during… A) Prophase B) Prometaphase C) S phase D) G2 phase E) Metaphase 17. In the assembly of mRNA, nucleotides are added to the ________ end of the growing strand. The correct order of nucleotides is obtained by reading the _______ strand. A) 5’; coding. B) 3 ‘; coding. C) 5’; template. D) 3’; template. E) More than one answer is correct because template and coding strand are synonyms. 18. The genetic code… A) contains three stop codons and two start codons. B) contains redundancies C) Contains ambiguities D) differs slightly between eukaryotes and prokaryotes E) has at least 2 codons coding for each Amino Acid. 19. Which statement about mRNA transcription, translation and processing is false? A) Introns are spliced out after transcription. B) Exons are spliced together before transcription. C) Introns and exons are transcribed before G-­‐cap and tail are added. D) The full strand of mRNA that crosses the nuclear membrane will not be translated. E) Exons are spliced together to form the coding sequence. 20. The amino acid methionine is connected to a molecule of tRNA. What is the sequence of nucleotide bases that compose this tRNA’s anticodon? A) UAC B) AUG C) GAU D) TAC E) MET 21. Translocation involves… A) the translocation of the large ribosomal subunit onto the small subunit. B) first, the release of tRNA from the A site and then the movement of the tRNA from the P site into the A site. C) first the release of tRNA from the P site and then the movement of tRNA from the A site to the P site. D) the formation of a new peptide bond. E) a single cycle of elongation. 22. Translation consists of which sequence of events? A) Amino acid attachment, initiation of peptide synthesis, translocation, termination. B) Peptide bond formation, translocation, termination. C) Codon recognition, elongation, termination. D) Amino acid attachment, elongation, termination. E) Amino acid attachment, initiation of peptide synthesis, elongation, termination. 23. During peptide bond formation the peptide chain is moved to the tRNA molecule at the… A) A site of the large ribosomal subunit B) A site of the small ribosomal subunit C) Anticodon of the large ribosomal subunit D) P site of the large ribosomal subunit E) P site of the small ribosomal subunit Use this information to answer 24, 25 and 26: the following sequence represents a gene. There are introns between, and including, the 1st and 2nd bolded letters and the 3rd and 4th bolded letters. AACGAGTACTCGCCCCATGCCTGTTGTATATAGTTTACTTTTAGCCTGTTGTTATAA 24. Choose the option that best represents what an mRNA transcription of this piece of DNA would look like when it leaves the nucleus. A) AUGAGCACAACAUAUAUCAAA B) GUUGCUCAUGAGCGGGGUACGGACAACAUAUAUCAAAUCGUGAAAAAAAAAA C) GUUGCUCAUGAGCACAACAUAUAUCAAAUGAGACAACAAUAUUAAAAAAAAAA D) GGGGGUACGGAAAUCGAAAAAAAA E) GAUGAGCACAACAUAUAUCAAAAAAAAAAAA 25. What is the amino acid sequence of the correct mRNA strand from question 24? A) MET SER THR THR PRO ILE LYS B) MET SER GLY VAL ARG THR THR TYR ILE LYS LYS SER C) GLY VAL ARG LYS SER D) MET SER THR THR VAL ILE LYS E) MET SER THR THR TYR ILE LYS 26. Imagine that the second bolded nucleotide (a cytosine) in the DNA sequence is changed to an adenine base. This would cause a __________ mutation and __________ alter the reading frame A) Nonsense mutation; will. B) Missense mutation; will not. C) Nonsense mutation; will. D) Missense mutation; will not. E) Silent mutation; will not. 27. Which of the following, with regards to transcription, is false? A) Transcription is unidirectional. B) The double helix re-­‐joins shortly after RNA polymerase II reads the template strand C) Prokaryotic mRNA can be translated as it is being transcribed. D) RNA polymerase II requires transcription factors to add an RNA primer that the polymerase can then latch onto to begin transcription. E) More errors are made by the polymerase in transcription than by the polymerases in DNA replication. 28. The G-­‐cap functions to: A) 1. protect degradation of the mRNA strand 2. facilitate transport of mRNA 3. facilitate binding to the A site of a ribosome. B) 1. protect degradation of the mRNA strand 2. facilitate transport of mRNA 3. facilitate attachment to a ribosome. C) 1. protect degradation of the tRNA strand 2. facilitate transport of tRNA 3. attach tRNA to the A site of a ribosome. D) 1. protect degradation of the tRNA strand 2. facilitate transport of tRNA 3. attach tRNA to the P site of a ribosome. E) 1. protect degradation of exons 2. facilitate transport of mRNA 3. facilitate attachement to a ribosome. 29. Which of the following mutations has the potential to be most damaging? A) Nonsense B) Insertion C) Missense D) Deletion E) Both B and D 30. Which of the following can be said for both DNA and RNA? A) can contain the nucleotide Thymine. B) assembly is terminated by a stop codon. C) is directly involved in the process of translation. D) is an integral part of the central dogma. E) Both B and C.