Download Practicing Transcription and Translation

Practicing Transcription and Translation
by Ann Murkowski
Transcribe and translate the following molecules. In each example, the template
strand is the bottom strand of the DNA sequence. Transcribe the entire template
strand, showing the RNA molecule produced. Remember to start translating at the
first start codon you find. Please use the one letter code for the amino acid to
indicate the sequence of the protein this DNA fragment codes for!
1)
5’ gcgtatggctgggaacgagacctaagcg 3’
3’ cgcataccgacccttgctctggattcgc 5’
2)
5’ tgcgtatggcaatccttgaagactgagcg 3’
3’ acgcataccgttaggaacttctgactcgc 5’
3) 5’ agctgatggaggcctctctagaatgagcg 3’
3’ tcgactacctccggagagatcttactcgc 5’
4) 5’ gcgtatggaaaacgacgaactgtaagcg 3’
3’ cgcataccttttgctgcttgacattcgc 5’
5) 5’ gtgatgatactcgacgaatggtgagcg 3’
3’ cactactatgagctgcttaccactcgc 5’