Download DNA Transcription and Translation Practice

DNA Practice Exam
1.
2.
3.
4.
5.
6.
Name:________________________
Total number of amino acids _____________
Number of nitrogen bases found in DNA _____________
Number of nitrogen bases found in an anticodon _____________
Number of nitrogen bases found in a codon _____________
Number of strands that make up RNA _____________
Number of errors in a point mutation _____________
7. Original (template) DNA strand
TACTGCCTTATACATTACGGGTTAGAGATC
8. Replicate the original strand of DNA into a complimentary strand of DNA
_____________________________
9. Transcribe the original strand of DNA into mRNA
_____________________________
10. Divide the above strand of mRNA into triplet codons
11. Identify the anticodons attached to the tRNA that will match with the codon on the
RNA strand
12. Translate the codons into Amino acids
1. Original (template) DNA strand
TACCCCCTTGGAATTCCAATTAGAGCTATC
2. Replicate the original strand of DNA into a complimentary strand of DNA
_____________________________
3. Transcribe the original strand of DNA into mRNA
_____________________________
4. Divide the above strand of mRNA into triplet codons
5. Identify the anticodons attached to the tRNA that will match with the codon on the
RNA strand
6. Translate the codons into Amino acids