* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Week 10 Pre-Lecture Slides
Mitochondrial DNA wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
SNP genotyping wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genomic imprinting wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gene therapy wikipedia , lookup
Oncogenomics wikipedia , lookup
Pathogenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Public health genomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Metagenomics wikipedia , lookup
Transposable element wikipedia , lookup
Epigenomics wikipedia , lookup
Gene expression profiling wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Primary transcript wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Point mutation wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Molecular cloning wikipedia , lookup
Microsatellite wikipedia , lookup
Human genome wikipedia , lookup
Minimal genome wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genome evolution wikipedia , lookup
Genome (book) wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genome editing wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Designer baby wikipedia , lookup
Monday March 6th, 2017 Class 35 Learning Goals Biotechnology: PCR • After this class, you should be able to: – Diagram any stage of a PCR reaction – Predict the next stage in a PCR reaction and explain the types and sizes of molecules present – Describe the process of designing PCR primers – Understand the process of PCR enough to hypothesize uses for PCR in analyzing different kinds of DNA-related issues Amplifying DNA: The need for many copies • • • • In chemistry, you’ve use purified solutions of a single molecule to analyze the characterize that molecule We need to produce many copies of a single DNA region The Polymerase Chain Reaction is a method for making many copies of a single, specific region from any larger DNA This is called ‘amplification’ Peer Instruction Explain how this reaction is limited to a single location in the genome. Design a DNA primers matching these regions 5 3 3 5 Region of DNA to be amplified by PCR When target DNA is single-stranded, -primers bind -create an accessible 3’OH -allow DNA polymerase to bind and polymerize 5 3 5 3 Primer Primer 3 5 3 5 PCR: Resetting the cycle Primers 5 3 5 3 3 5 3 5 dNTPs Temperatures for each step: 1) Denaturation: 90-96C 2) Annealing: 50-60C 3) Extension: 67-72C PCR: Extending , Cycling 5 3 5 5 3 5 5 3 3 5 5 3 3 5 Explain “Gel Electrophoresis” + + + + Peer Instruction A mixture of DNAs What charge do pieces of DNA have? In what direction does DNA move through this electrified gel? Why do shorter fragments move farther through the gel? Tuesday March 7th, 2017 Class 36 Learning Goals Biotechnology: Genetic Modification • After this class, you should be able to: – Describe each step needed for a human immune gene therapy procedure. – Compare and contrast • human gene therapy with retroviruses, • plant genetic modification with agrobacterium, and • DNA modification with CRISPR/Cas. – Analyze a gene therapy scheme and point out logistically difficult parts of the procedure Cloning: Copying a biological entity by an artificial method In this case*, cloning is the copying of a gene sequence for insertion into another genome. *This is different than cloning an entire organism from a cell. Cloning: Reverse Transcriptase Central Dogma: DNA RNA Protein Reverse Transcriptase: (developed from viruses) Single-stranded “cDNA” Double-stranded cDNA Primer Reverse transcriptase mRNA DNA polymerase Restriction endonucleases BamH1 is an enzyme found in a strain of the bacteria Bacillus amyloliquefaciens. Peer Instruction DNA This enzyme can cut DNA as shown here: The sequence GGATCC is a palindrome that Is not found in the Bacillus genome. 1) How do bacteria naturally use the enzyme to destroy viruses? BamH1 is one of thousands of different “restriction endonucleases”. Cut sites for different REs 2) How would a human biologist use a RE? 3) Why is a ‘sticky end’ more useful than a typical double-stranded break? DNA of E. coli Cloning: Plasmid Insertion To carry and keep this gene safe, we’ll load it onto a circular DNA plasmid Recognition site Recognition site 5 3 3 5 5 3 Restriction endonuclease (EcoR1) 3 5 Plasmid Sticky end Transformation: Plasmid Vector Plasmid DNA ligase catalyzes a phosphodiester bond Recombinant plasmid E. Coli cells Recombinant plasmid What is happening in this reaction? Peer Instruction Why is a human retrovirus involved? Viral RNA Human RNA DNA complementary to introduced RNA Double-stranded DNA of introduced genes Human cell Host DNA Reverse transcriptase Peer Instruction This patient has two defective copies of an immune-related gene that works in B-cells. 1) What are his doctors attempting? 2) What are these operations like for the patient? 3) Can they prevent the virus from inserting in important regions of B-cell DNA? SCID patient A plant vector… Peer Instruction Agrobacterium cell Ti plasmid Genes that help insert the T-DNA Main chromosome T-DNA Genes and promoters that increase cell growth Host-cell chromosomes How does the Agrobacterium make a safe structure for itself in its host? Plant cell nucleus Inserted T-DNA Agrobacterium cells Explain vector preparation in Agrobacterium. Tumor-inducing genes 1. Start with normal T-DNA Ti plasmids 2. Remove tumorT-DNA inducing genes. 3. Add genes for Genes for three enzymes enzymes required for carotene synthesis along with promoter that will be activated in endosperm. Peer Instruction Peer Instruction Binds to the Cas9 enzyme A guide RNA: Complementary to a genomic sequence The gRNA enters the nucleus… Cas9 is guided to the site and cuts the DNA The Cas9 enzyme: • Naturally occurring in bacteria • Can be transfected into any cell What can the Cas9 enzyme do that vectors cannot? Peer Instruction Binds to the Cas9 enzyme A guide RNA: Complementary to a genomic sequence The gRNA enters the nucleus… Break a particular sequence Cas9 is guided to the site and cuts the DNA Add a dsDNA for insertion/replacement Bring a regulating factor to the site Wednesday, March 8th, 2017 Class 37 Learning Goals Genomics • After this class, you should be able to: – Assess the likelihood of finding a particular kind of gene in a human genomic region – Describe comparative features of several genomes – Build a small gene map from recombination data – Describe the differences between a genome, an enterome, a proteome, a transcriptome, and a biome. Crossing over in Meiosis Gene 1 Gene 2 Crossing over is rare between genes that are close together Gene 1 Crossing over occurs frequently between genes that are far apart Gene 3 Mapping a chromosome: recombination rates radi ceto drckl abo elbow Forty.2 radi 0 50 19 18 17 4 ceto 50 0 50 50 50 50 drckl 19 50 0 37 2 15 abo 18 50 37 0 35 22 elbow 17 50 2 35 0 13 Forty.2 4 50 15 22 13 0 How to start? On a chromosome, elbow and forty.2 are separated by 13 distance units. Radi is 4 units away from forty.2, so it must be in one of two places… Genetic Mapping: Huntington’s Disease Close physical association between recognition site and defective allele. Genetic marker restriction sites absent Chromosome of diseased individual Chromosome of healthy individual Defective Huntington’s gene (disease allele) Normal Huntington’s gene Genetic marker restriction sites present Genetic markers at other locations are equally likely to be found in affected and unaffected individuals Peer Instruction HD brain: What causes Huntington’s disease? Normal Htt protein Wt brain: Mutant Htt protein Normal allele: ATGCGCGTGATAGCTGATAGCGAGCAG[26xCAG]CAGTTAGCGATTA… M R V I A E S D Q 26xQ Q L A I… Disease causing allele: ATGCGCGTGATAGCTGATAGCGAGCAG[150+ x CAG]CAGTTAGCGATTA… M R V I A E S D Q 150xQ Q L A I… First genome sequenced: a 3,500 bp RNA phage ‘76 First DNA genome: a 5,000 bp DNA phage in ‘77 First prokaryote: A bacteria in ‘95 (1.8 million bp) First eukaryote: A yeast in ‘96 (12 million bp) First animal: C. elegans worm in ‘96 (100 million) Human genome “finished”: ‘00 (~70% of 3.2 billion bp…currently ~93%) Current # of genomes: 180+ and growing Year Billions of nucleotides sequenced Genome Sequencing Sequencing: Two methods: Slow and Shotgun primer new sequence known sequence ~160-kb fragments 1. Cut DNA at random locations into fragments of ~160 kb. Genomic DNA BAC library 1-kb fragments “Shotgun clones” Shotgun sequences BAC Main bacterial chromosome Many copies (three shown) of each 160-kb fragment, each cut differently 2. Clone using BACs. 3. Cut into 1-kb fragments. 4. Clone using plasmids. 5. Sequence each fragment. 6. Assemble all the 1-kb fragments. Draft sequence 7. Assemble all the 160-kb fragments. Peer Instruction This is data from the human genome. What do you notice? Repeated DNA (centromeres, telomeres) Genes ‘Junk’ DNA Mobile genetic elements like transposons (both viable and ‘dead’) What do you notice about that 5% labeled ‘genes’? Peer Instruction Protein trafficking Cell cycle Cell proliferation and differentiati Cell structure and motility Transport Immunity and defense Unknown Developmental processes Other metabolism Misc. function Signal transduction Protein metabolism and modification Nucleoside, nucleotide, and nucleic acid metabolism Peer Instruction Genome size (Mbp) What does this data tell us? Nonparasitic bacteria Parasitic bacteria Number of protein-encoding genes Can you find a trend in genome size and number of genes? What would be most closely related to a species with 220 million base pairs and ~27,000 genes? Developmental processes Protocadherins are the largest subgroup within the cadherin family of Ca-dependent cell-cell adhesion molecules. Interestingly, many of the protocadherins in mammals are highly expressed in the central nervous system. In the postnatal mammal brain, protocadherins are possibly involved in the modulation of synaptic transmission and the generation of specific synaptic connections. Human Octopus Total amount of DNA 3.1 gbp 2.7 gbp Total # of genes ~25,000 <33,000 Total # of protocadherin genes 58 168 What happened in octopus evolution? Unique arm neurons in this mollusk allow highly coordinated creative sensory and motor action…even to act independently. This distributed neural network makes octopi uniquely intelligent among invertebrates. Here is a species with 220 million base pairs and ~27,000 genes: Tetrahymena: • Unicellular • Ciliate • Rotifer bacterial prey Gene duplication and evolution 8 repeats 1. Homologs pair up. 8 repeats 2. Repeats misalign. Crossing over and recombination occur. Chromosomes break and exchange here 10 repeats 3. Products are unique. 6 repeats Globin gene family Pseudogene Coding gene Proteome research • The set of all proteins in a cell is the ‘proteome’ • Because protein is the functional unit in many systems, analyzing protein levels can give exact data – Can decipher alternative splicing variations – Can account for post-translational modification and degradation – Allows for time-sensitive analysis of signals and responses – However, it is very difficult due to the variety of structures possible • Mass spectrometry can help analyze cell protein content • Large-scale binding searches Transcriptome Research: Microarrays Normal temperature High temperature Example of a functional genomics comparison 1. Isolate mRNAs and use reverse transcriptase to prepare singlestranded cDNA. Reverse transcriptase mRNA cDNA cDNA probes 2. Make cDNA probes. Microarrays: Visualizing the data 3. Probe a microarray. Microarray Microarray computer output: 4. Shine laser light on one spot at a time to induce fluorescence. Each gene transcribed in the experimental condition is a candidate for further research… Green spots: Yellow spots: genes genes transcribed transcribed at normal equally in temperature both cells Dark spots: low gene expression Red spots: genes transcribed at high temperature Thursday March 9th, 2017 Class 37 Learning Goals Antibiotics and the Human Microbiome • After this class, you should be able to: – Express antibiotics as a temporary and limited means of controlling rapidly evolving bacteria – Describe multiple differences between similar individuals in terms of their microbiota – Hypothesize causes or potential treatments for human diseases based on microbiomal disruptions Peer Instruction What do these data tell us about human health care? In your body: Human cells: somewhere between 20-40 trillion Human cells: only about 50% of the total… What is a microbiome? What is an enterotype? …Here Peer Instruction is the other 50% Peer Instruction How can microbiomes differ between people? What are the differences between young and old people? What are the overall differences between these ethic group? Peer Instruction What would be the most efficient way to donate fecal microbiota from one person to another? Hint: How could you use microbiome information to tell who has been in a room or not? Why should new parents create skin to skin contact with babies? Why are researchers interested in gastric cancer starting to focus on the enteromes of their patients?