* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Soybean (Glycine max L.) Nuclear DNA Contains
DNA polymerase wikipedia , lookup
Pathogenomics wikipedia , lookup
Non-coding RNA wikipedia , lookup
Oncogenomics wikipedia , lookup
Chloroplast DNA wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Genome (book) wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Transposable element wikipedia , lookup
Minimal genome wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genetic engineering wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA vaccination wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
Metagenomics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA supercoil wikipedia , lookup
Human genome wikipedia , lookup
Molecular cloning wikipedia , lookup
SNP genotyping wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Designer baby wikipedia , lookup
Genomic library wikipedia , lookup
Primary transcript wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Deoxyribozyme wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
FORSCHUNG 247 Chimia 47 (1993) 247-249 © Neue Schweizerische Chemische Gesellschaft ISSN 0009-4293 Soybean (Glycine max L.) Nuclear DNA Contains Four tufA Genes Coding for the Chloroplast-specific Translation Elongation Factor EF- Tu Christophe Bonnya) and Erhard Stutz* Abstract. The chloroplast tufA gene codes for the translation elongation factor EF- Tu. In algae like e.g. Euglena tufA is part of the chloroplast DNA but in land plants the equivalent gene is transposed to the nuclear DNA. Using a previously sequenced Euglena gracilis tufA DNA probe a cDNA library from soybean was screened. Two cDNA clones (cDNAI and cDNA2) were sequenced (ca. 500 nucleotides) and shown to contain parts of the chloroplast tufA gene. A cDNAI fragment was used to screen a genomic library and one complete tufA gene was sequenced including 640 nucleotides of the region upstream of the transcription start site which was identified by S 1 endonuclease protection experiments. The soybean genome contains four tufA genes which belong to two subfamilies with two members each. TufA mRNA is absent in dark grown seedlings but light grown seedlings contain a stable tufA mRNA of ca. 1.6 -1.7 kb. The open reading frame codes for a chloroplast transit peptide (71 amino acids) and a very conservative chloroplast EF- Tu protein. Introduction Chloroplasts are considered to be endosymbionts of prokaryotic origin having invaded in an evolutionary past nucleated heterotrophic cells. During evolution parts of the. organellar genome were transposed to and successfully integrated in the nuclear genome ,i.e., structure and function of the photosynthetic organelle depend on both chloroplast and nuclear DNA encoded gene products. Recent comparative sequence studies indicate that number and kind of genes located on chloroplast genomes from different chlorophytes vary. A case in point is the tufA gene which codes for the translation elongation factor EF- Tu. This GTP requiring protein interacts with aminoacyl-tRNA and delivers it to the ribosomal A-site during the transla- 'Correspondance: Prof. E. Stutz Laboratoire de Biochimie vegetale Universite de Neuchatel Chantemerle 18 CH-2000 Neuchatel a) Present address: Northwestern University BMBCB Evanston, Ill. 60208, USA tion elongation step. Photosynthetic algae like e.g. Euglena gracilis [1] and Chlamydomonas reinhardtii [2] contain a single tufA gene in the chloroplast genome but this gene is missing from the chloroplast DNA of all examined land plants [2]. A single nuclear tufA gene was mapped and sequenced in Arabidopsis thaliana [2][3] and multiple copies of this gene seem to existin the nuclear genome of other Brassicaceae [3]. Two tufA genes were mapped and totally sequenced in Nicotiana sylvestris [4]. In the following we report about structure and expression of tufA genes located in the soybean nuclear genome. transcribed tufA genes exist. Equivalent fragments were cut from both cDN A samples (cDNAl and cDNA2) and used as probes in Southern experiments (Fig. 1). We see that either probe interacts with four HindIII fragments albeit in adifferential manner: cDNA2 (panel I) gives a strong signal with the two middle sized fragments whilecDNAl (panels 2, 3) preferentially interacts with the shortest and the longest of the four fragments. This indicates that the soybean genome contains four tufA genes and that the four genes belong to two related families with two members each. Note that soybean is an amphidiploide plant [6] and each parent may have contributed two tufA genes. A tufA cDNAI probe (360 bp) was used to screen a genomic DNA library [5]. We show in Fig. 2 a fragment (2313 positions) containing one complete tufA gene coding for the EF-Tu protein and a Nterminal peptide of 71 amino-acids with structural features of a chloroplast transit peptide [7]. The decoded EF-Tu protein starting with A(72) has e.g. 95 and 88% sequence similarity with the A. thaliana [2] and the E. g racWs [1] counterparts and 77 and 84% similarity with the yeast mitochondrial [8] and the bacterial [9] EF- Tu proteins. Note that the sequence 5'GCCAUGG is in line with the consensus sequence of competent initiator co- 123 23.1_ 6.6- Results and Discussion We used a 2 kb (kilo basepairs) tufA DNA probe from Euglena gracilis to screen a cDNA library from soybean [5]. Two positive clones were selected and the inserts sequenced (data not shown). Both inserts contained segments coding for the C-terminal part of EF-Tu. A sequence comparison of equivalent parts of the two inserts of ca. 500 nucleotides revealed 84 and 95% sequence identy on the nucleotide and amino-acid level, respectively, clearly indicating that at least two actively Fig. 1. Southern blot of soybean nuclear DNA cut with HINDIIl. A filter imprint was first hybridized with the cONA2 probe (panel I) and after washing rehybridized with cONAl (panel 2); another filter imprint (panel 3) was hybridized with cONAl; size marker in kb. Hybridization conditions: 6 X SSC, 68°, ] 2 h. FORSCHUNG 248 CHIMIA 47 (1993) Nr. 6 (lulli) · . . . .. TTCCATCCTTATGAACTAAGTTTTTTCCTGACAATTATTTAATTTAATATTTAAACTTTGTTCTCAGTAATTCTTTTAATATAAAI " -640 -550 ICAI TTAATTTTATTTCTTGCAAATTTTAATTCTAGATAGACTAATAAGGTTGAATCATAAAAGAGAATCTCTCCTTCCTTTCGGGGAATAAAT · . . . .. ATGATAAACATAAAAACTTCAATAATTAACAAATATAAATATCAATATATAGCAACAAAAAGTAAAAAGTAAACAAATGAAAATATTAAA · . . . . . . . . AGCAAAATTAAAAAGAAGAACAAAAAGCAAAGCCTAAATTAACAAAATGAATAAATACTAAAATTTACCAAAAAAAAAAACACATTTTAA · ..... CTAGTTTGACTCCTCTCCAATTGACATAAAAAGACTTTGTGTTTGTGATACCCTAGGAGAGAATCTTTTTTTCCCATTTTAATATTTAAC -~~1 -461 " -460 -370 -280 -190 -100 171 261 441 531 621 711 -101 -11 II M A V S AATTTTTACATTACTCAATACACTACACTAACATAATCCTCTTCACTCTTCTCTTTCTATCCAAAATTCTCCACCAGCCATGGCAGTTTC 80 " SAT ASS K L ILL P HAS S S S S L N S T P FRS S T T TTCAGCAACAGCTTCCTCCAAACTCATACTATTGCCCCATGCATCATCATCCTCTTCCCTTAATTCCACACCCTTCCGCTCCTCCACCAC · . . . . . . . NTH K L T P L S S S F L H P T T V L R R T P SST T T P R CAACACCCACAAACTAACCCCTCTCTCCTCCTCCTTCCTCCACCCCACCACCGTCCTCCGCCGCACCCCTTCTTCCACCACCACCCCGCG . . . . . . . RTF T V R A A R G K FER K K P H V N I G T I G H V D H G TCGCACCTTCACCGTCCGCGCCGCCCGCGGCAAATTCGAGCGCAAGAAGCCCCACGTGAACATCGGCACCATCGGCCACGTGGACCACGG . 351 -191 . " 81 -281 CCTTCACCTTGCTTCAATTGCATCTGACTTGGGTTAATAGTGAGAGAAAGAGAAAGCAAAAGATGTGATCCAGTGCGTCCTCCAAAATTG · . . . . . . . . AGGCAGAAAAGAGGATAGAGCTGATATGAGGCCATCTTTTATCTATCCACACATTCACCAACATCACCAATAGATAACACAACAATACAC +1 -10 -371 170 260 350 " K TTL T A A L T MAL A A L G N SAP K K Y DEI D CAAGACCACCCTTACCGCTGCCCTGACCATGGCTCTTGCCGCCCTAGGCAACAGCGCCCCCAAAAAATACGACGAGATCGACGCCGCCCC · . . . . . . . E ERA R G I TIN TAT V EYE TEN R H YAH V D GGAGGAGCGCGCCCGAGGCATCACCATCAACACCGCCACCGTGGAGTACGAGACCGAGAACCGCCACTACGCCCACGTGGACTGCCCCGG . . . . . HAD Y V K N MIT G A A Q M D G A I L V V S GAD G CCACGCTGACTACGTGAAAAACATGATCACCGGCGCAGCCCAGATGGACGGCGCCATATTAGTCGTCTCCGGCGCCGACGGCCCCATGCC .. .. .. Q T K E H I I L A K Q V G V P N M V V F L N K Q D Q V CCAAACCAAAGAACACATAATATTAGCGAAACAAGTCGGTGTCCCCAACATGGTCGTGTTCTTAAACAAGCAAGACCAAGTCGACGACGA .. .. ELL Q L V E I E V R D L L S S Y E F P GOD T P I V AGAGCTTCTCCAACTAGTGGAGATAGAAGTCCGCGACCTTCTGAGCTCCTACGAATTCCCCGGTGACGATACCCCCATTGTCTCGGGCTC .. .. ALL ALE A L MAN P A I K R G 0 NEW V D KIF Q CGCGCTCTTAGCCCTAGAAGCACTCATGGCCAACCCTGCAATCAAACGCGGCGACAACGAGTGGGTCGACAAGATTTTCCAACTCATGGA · . . . . . . . E VON YIP I P Q R Q T 0 L P F L L A V E 0 V F SIT CGAGGTCGACAACTACATTCCCATCCCCCAGCGCCAGACCGACCTCCCCTTCCTCCTCGCCGTCGAAGACGTCTTCTCCATCACCGGCCG .. G T V A T G R V ERG T 1 K V GET VOL V G L RET TGGCACCGTCGCCACTGGCCGTGTAGAGCGTGGCACCATCAAAGTAGGGGAAACTGTTGACCTTGTAGGTTTGAGAGAAACAAGGAACAC A A P 440 C P G 530 P M P 620 D D E 710 S G S 800 " 801 891 L M 0 890 G R 980 " 981 T 1071 1161 1251 1341 1431 1521 1611 V T G V EMF Q K I L D E A LAG D N V G L L L R G R N T 1070 V Q K AACCGTCACAGGTGTAGAAATGTTCCAGAAGATTCTAGACGAAGCCCTGGCTGGAGACAACGTGGGGCTGTTGCTTAGAGGGGTTCAGAA · . . . . . . . T 0 I Q R G M V L A K P G TIT P H T K F S A I V Y V L K K GACTGACATTCAGAGGGGAATGGTGTTGGCTAAACCAGGCACGATTACGCCGCACACCAAGTTCTCAGCGATTGTTTATGTTTTGAAGAA · . . . . . . . E EGG R H S P F FAG Y R P Q F Y M R T T 0 V T G K V T S AGAAGAAGGTGGTAGGCATTCACCTTTCTTTGCAGGGTATAGGCCTCAGTTTTACATGAGGACCACCGATGTGACTGGGAAGGTTACGTC · .... I M N 0 K 0 E EST M V LPG 0 R V K M V VEL I V P V A C TATCATGAATGATAAGGATGAGGAGTCCACGATGGTGCTGCCCGGTGACCGTGTCAAGATGGTGGTGGAGCTTATTGTTCCTGTGGCTTG · . . . . . . E Q G M R F A IRE G G K T V GAG V I Q S I I E * CGAACAGGGAATGAGGTTTGCTATTAGGGAAGGTGGGAAGACCGTTGGTGCTGGTGTTATCCAATCCATTATTGAGTGAAAATTCTGTCA · . . . . . . . . CTTTATTTTTAATTAATTAATTTTTTCCGTTTTATACAGCTTCTGTACTTTGCTTTCCCTTTTTCTTATACTTTAATTGCACTTTTAGGA .. .. TGGATATTATTGGATAATAATATTTTTCTGTCCCAAATGAAAATGTCTTTGTTGTTCTTGTTA 1160 1250 1340 1430 1520 1610 1673 Fig. 2. Nucleotide sequence of a tufA gene [15]. The open reading frame is decoded, the first methionine (M) after the presumed transcription start site (pos. + 1, vertical bars) and the first amino-acid ofEF- Tu (A) are in bold letters. The lastA (pos. 1673) corresponds to the beginning of the poly(A) sequence of the cDNA I. A potential TAT A box (pos. -30 to -24) and a crucial cis element (pos. -420 to -388) are in bold letters. The DNA sequence complementary to the primer used for the synthesis of single-stranded DNA probes and the upstream HaeIII site (8 I-endonuclease-protection experiments) are underlined. FORSCHUNG 249 CHIMIA o 3 16 24 48 hrs 1.9_ 1.5_ Fig. 3. Northern blot of soybean RNA. RNA from soybean seedlings (dark grown, or exposed to light for the indicated time in h) were electrophoretically separated and filter imprints were probed with a 360 bp DNA fragment from cDNAI; size marker (margin) is in kb. Hybridization in 6 x SSC, 50% formamid, 42°, 12 h. AT P 81 A A A A A T G T A"(+1) A* T G A the coding region (consult Fig. 2). The longest protected fragment starts with AATG- what corresponds to the TTACsequence marked in Fig. 2. Identical results were obtained with longer DNA probes extending to position -520. Considering the size of the tufA mRNA (Northern) and the length of the transcript according to the S 1 experiment we can assume that this tufA gene has no intron in the coding part and most likely none within the promoter region (see below). This clearly distinguishes the tufA gene from the tef genes (coding for the eEF-I a translation elongation factor) which are interrupted by an intron both in the coding part and the upstream region [5]. We cloned the entire region upstream of the presumed transcription start site into an expression vector and tested the construct for promoter activity in transgenic tobacco (F. Maurer, Ch. Bonny, A. Spielmann, and E. Stutz, to be published). The resul ts obtai ned so far indicate that the upstream region (negative numbering in Fig. 2) acts as strong promoter. We mark in Fig. 2 two regions (bold letters) which may be instrumental in promoter function, i.e., a TATA-box like element near the transcription start site and a longer sequence (pos. -420 to -388) which is very similar Fig. 4. 51-Endonuclease-protection experiment. A primed single-strand DNA probe [II) covering a region starting with the primer (see Fig. 2) and extending to the HaeIII site was hybridized to RNA. Protected fragments (panel SI) were separated on a sequencing gel along with the A and T sequencing probes of the corresponding DNA fragment and the untreated DN A probe (panel P). The 13 nucleotides given in the margin are complementary to the sequence (pos. -8 to +5) of Fig. 2. dons [10]. The cDNAI sequence (932 positions of the 3' part, not shown) perfectly matches the genomic sequence given in Fig. 2, i.e., the tufA gene presented in Fig. 2 is transcribed. According to Northern experiments (Fig. 3) the tufA DNA probe interacts with a stable transcript of ca. 1.6 -1.7 kb. The band is absent in RNA samples from dark grown seedlings. Upon illumination the steady state level of the tufA mRNA sharply increases remaining at about the same level over the monitored time (48 h). In order to identify the transcription start site we made S I-endonuclease- protection studies using in vitro synthesized single-strand DNA fragments [11]. The result given in Fig. 4 was obtained with a DNA probe going from the RaeIII site in the upstream region to the priming site in to a 'cis' element in the promoter region of pea rbcS genes [12] considered to be involved in the light-induction process. Experimental Isolation of DNA. DNA from soybean leaves was isolated following the procedure of Shure et al. [13). Fresh leaves frozen in liquid N2 (5-10 g) are ground to a fine powder and resuspended in 8 ml/g leaves of lysis buffer (8M urea, 0.35M NaC], 0.05M Tris-C], pH 7.5, 0.02M EDTA, 2% sarcosyl and 5% phenol). The suspension is homogenized by gentle shaking. One volume of phenol/CHClJ 3: 1 is added and sodium dodecyl sulfate (SDS) to a final concentration of 0.5%. Subsequent steps of DNA extraction are as described [13]. The yield of RNA-free DNA is ca. 0.1 mg DNAlg leaves. Isolation of RNA. The procedure of Dean et al. [14] was followed. Fresh leaves frozen in liquid N2 (batches of 2 g) are ground to a fine powder and resuspended in 2.25 ml/g leaves of lysis buffer (O.IM NaCl, I mM Tris-CI, pH 7.5, ImM EDTA, 1% SDS). The suspension is homogenized by gentle shaking before adding one volume of phenol/CHClJ I: I). Subsequent steps af RNA extraction are as described [14]. The yield of DNA-free RNA is ca. 2 mg/g leaves. Blotting and Hybridization. Transfer of ge]electrophoretically separated RNA (Northern blot) and DNA (Southern blot) to filters was according to standard procedures [II]. Hybridization of filters with J2P-]abelled DNA probes was done in buffer 6 x sse (SSC = 0.15M NaCl, 0.015M 47 (199JI Nr. 6 (Juoi) trisodium citrate, pH 7.0) and I x Denhardt's (50 x Denhardt's = ] % Ficoll, 1% polyvinylpyrrolidine, I % bovine serum albumin). For hybridization conditions see legends to Figs. 1 and 3. Cloning of DNA Fragments and DNA Sequencing. The protocols described in detail in [I]] and the instructions of the suppliers ofvectors, plasmids, and enzymes (Boehringer, Mannheim and Stratagene, La Jolla) were followed. J2P-Labelling of Single-Strand DNA and S 1Endonuclease-Protection Experiments. The protocol of Sambrook et al. [I ]] was followed using a construct (pBluescript II KS-) containing the EcoRI-XbaI fragment (1.3 kb) which carries 590 nucleotides upstream of the start codon (AUG). A DNA primer (l7-mer) complementary to nucleotide positions 40 to 25 (see Fig. 2) was used to copy the insert in the presence of a-uPdATP (400 Ci/mmol, 10 mCi/ml, Amersham). We are grateful to Dr. A. Spielmann for helpfu] advice and Sophie Marc-Martin for technica] assistance. This work receives support from the Swiss National Science Foundation (to E.S.) and it is part of the Ph.D. Thesis of Ch. B. submitted to and accepted by the Faculte des Sciences, Universite de Neuchiitel. Received: April 6, 1993 [1] P.E. Montandon, E. Stutz, Nucleic Acids Res. 1983,11,5877. [2] S.L. Baldauf, J.D. Palmer, Nature (London) 1990, 344, 262. [3] S.L. Baldauf, J.R. Manhart, J.D. Palmer, Proc. Natl. A cad. Sci. U.S.A. 1990, 87, 5317. [4] Y. Murayama, T. Matsubayashi, M. Sugita, M. Sugiura, in 'Third Internationa] Congress of Plant Molecu]ar Biology' , Ed. R.B. Hallick, 199], Abstract 1949. [5] F. Aguilar, P.E. Montandon, E. Stutz, Plant Mol. Bioi. 1991, 17, 351. [6] M.A. Grandbastien, S. Berry-Lowe, B.W. Shirley, R.B. Meagher, Plant Mol. Bioi. 1986, 7, 451. [7] G. Von Heijne, J. Steppuhn, R.G. Herrmann, Eur. J. Biochem. 1989, 180,535. [8] S. Nagata, Y. Tsunetsugu-Yokota, A. Naito, Y. Kaziro, Proc. Natl. Acad. Sci. U.S.A. 1983,80,6192. [9] T. Yokota, H. Sugisaki, M. Takanami, Y. Kaziro, Gene 1980, 12, 25. [10] M. Kozak, Nucleic Acids Res. 1981, 9, 5233. [II] J. Sambrook, E.F. Fritsch, T. Maniatis, 'Mo]ecu]ar Cloning: A Laboratory Manua]' , Cold Spring Harbor Laboratory, 1989. [12] R. Fluhr, C. Kuh]emeier, F. Nagy, N.H. Chua, Science 1986, 232, 1106. [13] M. Shure, S. Wessler, N. Federoff, Cell 1983, 35, 225. [14] C. Dean, T. Tamaki, P.M. Dunsmuir, M. Favreau, C. Katayama, H. Dooner, J. Bedbrook, Nucleic Acids Res. 1986, 14,2229. [15] The nucleotide sequence appears in the EMBL, GenBank and DDBJ Nucleotide Sequence Database under the Accession number X66062 (G. max tufA gene for ch]oroplast elongationfactor EF- Tu).