* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download G - AP Bio Take 5
Long non-coding RNA wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Frameshift mutation wikipedia , lookup
Human genome wikipedia , lookup
RNA interference wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular cloning wikipedia , lookup
Designer baby wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Epigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Microevolution wikipedia , lookup
RNA silencing wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Expanded genetic code wikipedia , lookup
Polyadenylation wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Genetic code wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
From Gene to Protein How Genes Work 2007-2008 What do genes code for? How does DNA code for cells & bodies? DNA how are cells and bodies made from the instructions in DNA proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication RNA protein DNA gets all the glory, but proteins do all the work! trait Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway A enzyme 1 Am I just the sum of my proteins? disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008 Facts about RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs DNA mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription: Making mRNA The parts: transcribed DNA strand = template strand untranscribed DNA strand = coding strand The complementary RNA strand is same sequence as coding strand Uses enzyme: RNA polymerase coding strand build RNA 535C (same as DNA G coding strand) 3 A G T A T C T A G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA 5 RNA polymerase template strand The Enzymes! RNA polymerases There are 3 RNA polymerase enzymes RNA polymerase 1 RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes rRNA genes which go to ribosomes makes ribosomes only transcribes tRNA genes each has a specific promoter sequence it recognizes How to „know‟ which gene is read? (2 regions) Promoter region Located before gene Begins with „TATA‟ box binding site What does it do? This is the binding site for RNA polymerase & transcription factors Enhancer region Additional binding site far upstream of gene What are Transcription Factors? They are Initiation complex („start‟ complexes) transcription factors bind to promoter region This is a suite of proteins which bind to DNA turn on or off transcription They trigger the binding of RNA polymerase to DNA RNA polymerase : Matches bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T U C Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk introns come out! inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence mRNA splicing – after transcription What is spliced? primary transcript = This is pre-mRNA When mRNA is spliced….the INTRONS are edited out! make mature (final) mRNA transcript intron = noncoding (inbetween) sequence ~10,000 base eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript mature mRNA transcript ~1,000 base spliced mRNA Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP| RNA splicing enzymes CALLED: snRNPs (small nuclear RNA) proteins Spliceosome snRNPs snRNA intron exon exon several snRNPs 5' recognize splice site sequence 3' cut & paste gene spliceosome 5' 3' lariat 5' mature mRNA exon 5' 3' exon 3' excised intron Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments can be treated as exons Starting to get hard to define a gene! More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm…WHY? enzymes in cytoplasm attack mRNA How does protection occur? protect the ends of the molecule by: add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein 3' mRNA 5' P G P P A a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait Translation from nucleic acid language to amino acid language 2007-2008 How does mRNA code for proteins? DNA 4 ATCG TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC 4 AUCG protein ? Met Arg Val Asn Ala Cys Ala 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? mRNA codes for proteins in triplets DNA TACGCACATTTACGTACGCGG codon mRNA AUGCGUGUAAAUGCAUGCGCC ? protein Met Arg Val Asn Ala Cys Ala Who Cracked the code? 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids created artificial UUUUU… mRNA found that UUU coded for phenylalanine The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Start codon AUG methionine Stop codons UGA, UAA, UAG How are the codons matched to amino acids? DNA 3 5 5 3 TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC 3 codon 5 UAC tRNA amino acid GCA anti-codon CAU Met Arg Val Same code as DNA! a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome aa trait Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon IS this an organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain Met E site (exit site) empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Building a polypeptide Initiation Elongation brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination 3 2 1 end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C U GA A U mRNA A U G 3' E P A 5' UAC GAC A U G C U GA A U 5' 3' U A C GA C A U G C U G AAU 5' 3' U AC G A C AA U AU G C UG 3' A CC U GG U A A 3' Protein targeting See role of Signal peptide Destinations: Start here inside cell start of a secretory pathway secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail large ribosomal subunit polypeptide 5' small ribosomal subunit tRNA E P A ribosome 3' The Transcriptional unit (gene?) enhancer 1000+b 20-30b 3' RNA TATA polymerase translation start TAC translation stop exons transcriptional unit (gene) 5' DNA ACT DNA UTR promoter UTR introns transcription start transcription stop 5' pre-mRNA 5' GTP mature mRNA 3' 3' AAAAAAAA Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall 2007-2008 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing Any Questions?? What color would a smurf turn if he held his breath? 2007-2008 Substitute Slides for Student Print version 2007-2008 Can you tell the story? The Transcriptional unit enhancer exons 1000+b 20-30b 3' RNA TATA polymerase TAC transcriptional unit 5' DNA ACT introns 5' 3' 5' 3'