Download Identification of the Minus-Dominance Gene Ortholog in

Copyright Ó 2008 by the Genetics Society of America
DOI: 10.1534/genetics.107.078618
Identification of the Minus-Dominance Gene Ortholog in the Mating-Type
Locus of Gonium pectorale
Takashi Hamaji,*,1 Patrick J. Ferris,† Annette W. Coleman,‡ Sabine Waffenschmidt,§
Fumio Takahashi,** Ichiro Nishii†† and Hisayoshi Nozaki*
*Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan, †Plant Biology Laboratory,
Salk Institute, La Jolla, California 92037, ‡Division of Biology and Medicine, Brown University, Providence, Rhode Island 02906,
§
Institute of Biochemistry, University of Cologne, Cologne 50674, Germany, **Department of Biomolecular Sciences,
Graduate School of Life Sciences, Tohoku University, Sendai-shi, Miyagi 980-8577, Japan and
††
Frontier Research System, RIKEN, Wako-shi, Saitama 351-0198, Japan
Manuscript received August 8, 2007
Accepted for publication November 6, 2007
ABSTRACT
The evolution of anisogamy/oogamy in the colonial Volvocales might have occurred in an ancestral
isogamous colonial organism like Gonium pectorale. The unicellular, close relative Chlamydomonas reinhardtii
has a mating-type (MT) locus harboring several mating-type-specific genes, including one involved in
mating-type determination and another involved in the function of the tubular mating structure in only one
of the two isogametes. In this study, as the first step in identifying the G. pectorale MT locus, we isolated
from G. pectorale the ortholog of the C. reinhardtii mating-type-determining minus-dominance (CrMID) gene,
which is localized only in the MT locus. 39- and 59-RACE RT–PCR using degenerate primers identified a
CrMID-orthologous 164-amino-acid coding gene (GpMID) containing a leucine-zipper RWP-RK domain near
the C-terminal, as is the case with CrMID. Genomic Southern blot analysis showed that GpMID was coded
only in the minus strain of G. pectorale. RT–PCR revealed that GpMID expression increased during nitrogen
starvation. Analysis of F1 progeny suggested that GpMID and isopropylmalate dehydratase LEU1S are tightly
linked, suggesting that they are harbored in a chromosomal region under recombinational suppression that
is comparable to the C. reinhardtii MT locus. However, two other genes present in the C. reinhardtii MT locus
are not linked to the G. pectorale LEU1S/MID, suggesting that the gene content of the volvocalean MT loci is
not static over time. Inheritance of chloroplast and mitochondria genomes in G. pectorale is uniparental from
the plus and minus parents, respectively, as is also the case in C. reinhardtii.
O
OGAMOUS reproduction, which involves anisogamous fusion of distinctive sperm and egg cells,
has apparently evolved from isogamous sexual reproduction where gametes of different mating types are
very similar in size and appearance. Although oogamy
is known in animals and land plants, the origins of
oogamy are so ancient that there seem to be no extant
isogamous close relatives of them (Karol et al. 2001;
Rokas et al. 2005). The volvocine or colonial volvocalean algae are a model lineage for studying the evolution
of sexual reproduction for two reasons: first, they have
both isogamous (Gonium, Pandorina, and Yamagishiella)
and anisogamous/oogamous (Eudorina, Pleodorina,
and Volvox) genera, the latter forming bundles of male
gametes (sperm) and large female gametes (eggs), which
are phylogenetically well studied (Nozaki and Itoh
Sequence data from this article have been deposited with the DDBJ/
EMBL/GenBank Data Libraries under accession nos. AB353340,
AB353887–AB353889, AY860423, and DQ068275.
1
Corresponding author: Department of Biological Science, Graduate
School of Science, University of Tokyo, Tokyo 113-0033, Japan.
E-mail: [email protected]
Genetics 178: 283–294 ( January 2008)
1994; Nozaki et al. 2000); second, several mating-typespecific genes have been identified in the closely related isogamous, unicellular alga Chlamydomonas reinhardtii (Ferris et al. 1995; Ferris and Goodenough
1997). Therefore, the volvocine algae possess unrivaled
features for studying the evolution of sex in terms of
molecular biology (Kirk 2005).
Gonium pectorale has flattened 16-celled colonies and
produces isogametes in sexual reproduction. Heterothallic sexuality in G. pectorale with two mating types, plus
and minus, was studied by Schreiber (1925) and Stein
(1958). Although only one (plus) of the two conjugating
isogametes of C. reinhardtii has a tubular mating structure (TMS), both isogametes of G. pectorale extend a
TMS toward the other (Nozaki 1984; Nozaki and Itoh
1994). Phylogenetic analyses imply that anisogamous/
oogamous species of the colonial Volvocales evolved
from an ancestral colonial species that exhibits isogamy
as in G. pectorale (Nozaki and Itoh 1994; Nozaki et al.
2000). The genus Gonium is phylogenetically important, as it represents the most basal lineage within the
relatively advanced volvocine algae composed of isogamous genera and anisogamous/oogamous members
284
T. Hamaji et al.
(Nozaki et al. 2000). In C. reinhardtii the mating-type
(MT ) loci—mating type plus (MT1) and mating type
minus (MT )—consist of a 200-kb region dimorphic between the two mating types, referred to as the rearranged (R) domain, and include genes involved in
mating-type determination and in the function of the
TMS, as well as housekeeping genes with alleles present
in both MT loci. The dimorphism results in recombinational suppression over a region of 1 Mb (Ferris
and Goodenough 1994; Ferris et al. 2002).
The minus-dominance (MID) gene is one of the minusspecific genes in the MT locus of C. reinhardtii and was
demonstrated to be the master regulator in mating-type
minus determination (CrMID: Ferris and Goodenough
1997). CrMID contains an RWP-RK domain, which is a
characteristically conserved putative DNA-binding domain observed in plants, oomycetes, and cellular slime
molds (Schauser et al. 1999, 2005; Nozaki et al. 2006).
Ferris et al. (1997) identified only a single MID ortholog,
CiMID, from Chlamydomonas incerta, the closest known
relative to C. reinhardtii, although they attempted to find
MID orthologs from other Chlamydomonas species, G.
pectorale, and Volvox carteri by means of low-stringency
DNA gel blot hybridization. They concluded, from comparing divergence of housekeeping genes and MID, that
sex-related genes evolve very rapidly (Ferris et al. 1997;
P. J. Ferris, unpublished results). Recently, however,
the Pleodorina starrii minus-dominance gene ortholog
(PlestMID) was obtained by reverse transcribed (RT)–
polymerase chain reaction (PCR) from nitrogen-starved,
sexually induced males using degenerate primers designed from the RWP-RK domains of C. reinhardtii and
C. incerta (Nozaki et al. 2006). This result motivated us
to identify additional volvocine MID orthologs and, in
turn, the MT loci. The genomic changes accompanying
the evolution of sex will be elucidated by a step-by-step
analysis of the volvocine MT loci.
The G. pectorale MT locus, by analogy with the C.
reinhardtii MT locus, is likely to be a complex, recombinationally suppressed region of some hundreds of kilobases, containing a mix of housekeeping and sex-specific
genes, which would include the MID gene. To fully clone
and characterize this locus, we adopted a two-pronged
strategy: (1) identify the Gonium MID gene following
the Pleodorina example and (2) use genetics to confirm that the GpMID gene does indeed map to the sexdetermining MT locus and to identify housekeeping
genes contained within the Gonium MT locus to provide additional access points for a BAC-clone-based
chromosome walk.
Here, as the first step in characterizing the G. pectorale
MT locus, we isolated the G. pectorale ortholog of the MID
gene (GpMID). GpMID is encoded specifically in minus
strains of G. pectorale and strictly linked to certain nuclear genes, suggesting the presence of a MT locus
that is comparable to that of C. reinhardtii. In addition,
modes of organellar genome inheritance in G. pectorale
were examined and compared with those in C. reinhardtii
(Boynton et al. 1987) and in V. carteri (Adams et al.
1990). The evolutionary significance of GpMID and the
uniparental inheritance of chloroplast and mitochondrial genomes are discussed in this article.
MATERIALS AND METHODS
Experimental organisms and culture and mating methods:
The names of the two mating types of G. pectorale (plus and
minus) were assigned arbitrarily (Stein 1958), and since we
show here that the MT loci of both G. pectorale and C.
reinhardtii carry the MID gene, we have chosen to continue
with this usage. Four strains of G. pectorale were used here:
Kaneko3 (minus) and Kaneko4 (plus), originating from Okinawa
Prefecture, Japan (Yamada et al. 2006), and Mongolia 4
(minus) and Mongolia 1 (plus). The Kaneko strains have been
deposited in the Microbial Culture Collection at the National
Institute for Environmental Studies (Tsukuba, Japan; Kasai
et al. 2004) as NIES-1710 and -1711; the Mongolia strains are
deposited in the Culture Centre of Algae and Protozoa (CCAP,
Ambleside, Scotland; Gachon et al. 2007) as CCAP32/13 and
CCAP32/14. The Mongolia strains were isolated as single cells
from incubated petri dishes in which a small amount of dried
mud had been rewetted with distilled water, and they were
maintained in soil-water medium (Pringsheim 1946). The
mud samples were collected by R. A. Lewin (University of
California, San Diego) in October 1997. The mud came from
two small pools of freshwater adjacent to a large hypersaline
lake (Cha-gan-nur, Hao-tong-yin) in Inner Mongolia. Mating
types of Mongolia 4 and 1 were determined by crossing with
Alaska 1 and 2 strains (Fabry et al. 1998), whereas those of
Kaneko3 and -4 were tested against Mongolia 4 and 1.
The cultures of Kaneko3 and -4 were grown in AF-6, VTAC,
or standard Volvox media (SVM) (Starr 1969; Kasai et al.
2004) at 20°–25°, with alternating periods of 14 hr light
and 10 hr dark at a light intensity of 30–200 mmol photons m2 s1 provided by cool white fluorescent lamps. For
crossing, cells of these strains were grown in liquid Tris–
acetate–phosphate (TAP) medium (Harris 1989) on a light
shelf under constant illumination until growth appeared saturated (typically 4–5 days). The cells were then pelleted and
resuspended in nitrogen-free SVM medium (Starr 1969).
After sitting overnight, strains of opposite mating type were
mixed. Flagellar agglutination could be observed just after
mixing. Several hours after, the mixture was transferred to 4%
agar SVM plates and placed in the dark for at least 10 days. In
successful matings, the orange-colored zygotes were clearly
visible using a dissecting microscope. The zygotes were then
transferred from 4 to 1.5% agar TAP plates and manipulated
by hand to separate individual zygotes; germination was high,
but poor progeny survival obviated tetrad analysis. Consequently, a random progeny approach was adopted for the
genetic analysis. Matured zygotes on the plates were flooded
with liquid SVM, and cells loosened with a glass hockey stick
were transferred to a sterile tube and placed in a 20° freezer
overnight to kill unmated cells. After thawing, the zygotes were
spread on a TAP plate and incubated under light until colonies
were visible by the naked eye. Each colony represents the
surviving progeny from a single zygote. Colonies were subcloned before further characterization.
Cloning of GpMID: For isolation of the G. pectorale MID
gene, 14-day-old cultures of Kaneko3 and -4 in VTAC medium
were separately placed in petri dishes with an equal volume of
autoclaved MilliQ water. The petri dishes were then incubated
at 25° under a 14 hr light/10 hr dark cycle. After 2 days, both
Mating-Type Locus in Gonium
TABLE 1
Primers newly designed in this study
Primer name
dMT-dF3
GpMidF1
GpMidR3
GpMidR1
GPMID5P-1F
GPMID3P-1R
GPMID_int1F
GPMID_int4R
CV_EF1A1-R2
GpEF1A-INT3-R
gonact1
gonact2
gonypt1
gonypt2
pr46for
pr46rev
gac30
gac31
gonleu13
gonleu14
Mong4F1
Mong4R1
gonpsa1
gonpsa2
Primer sequence
RCIMRIAARGCIGAYYTIAC
AGCGCAGACATCAGTTCCTATTTCCA
AGGTACGTTGTCGAGATGCCCA
TGGAAATAGGAACTGATGTCTGCGCT
GTGATGCCGTACCCATATTGCCAC
GAACCCTTGCATGTGCCACCA
AACAATCCTCGTGTTGGACGTCTT
AGCTGGCCACCTTGCGATAC
CACGCTCGCCTGATCAACCTGCTG
GTCCAGACCCTTGATGTTCATGCC
GTGATCTCCTTCGACATGC
ACCATGTTCCCCGGTAAG
GGTCAACCAKGTGAMCTCC
GTGCGCTTCGCCTGAAGGG
AAGGTCACSTTCAAGGTNAC
ACCTCCTCSGCSGCGAAYTT
ACGCAGCATGGGAGCGGGTC
TGCAGGACGTACAGCACCTG
CAATCTCCTGAAGCGGGTAGGTCT
AGGGCGAGATGAAGACCGAATACC
CGGTCACGGCCAGAGAGGTA
GCAGATGCGCTTCAGGTACG
ATACTGCTCACCACCACGTAGCAA
AGGACCATCACAAGGGAAACGGAA
cultures were largely unicellular and commenced flagellar
agglutination within 1 hr if an aliquot from each was mixed.
Such sexually activated, nonmixed cells were used for isolation
of gamete RNA. Total RNA was isolated with the RNeasy Midi
kit (QIAGEN, Hilden, Germany; protocol for heart, muscle,
and skin tissue) after the cells had been homogenized with
ceramic beads and a wash brush (Nozaki et al. 1997, 2006).
Full-length cDNA synthesis from the total RNA was carried out
with the CapFishing full-length cDNA premix kit (Seegene,
Seoul, Korea). Nested RT–PCR using this cDNA yielded the
partial fragment of GpMID; the primers used in the first PCR
were the Seegene kit’s 39-rapid amplification of the cDNA end
(39-RACE) primer and dMT-dF3 (primers designed in this
study are listed in Table 1); the primers used in the second PCR
were dMT-dF3 and mt-R4 (Nozaki et al. 2006). The PCR
reactions were carried out using TAKARA Taq polymerase
(TAKARA, Osaka, Japan) using the cycling conditions described previously (Nozaki et al. 1995). To determine the C
terminus sequence of GpMID, 39-RACE was performed with
the 39-RACE primer of the kit and GpMidF1. The N terminus
sequence was determined using the 59-RACE system (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol;
the first antisense gene-specific primer was GpMidR3; the
second gene-specific primer was GpMidR1. The resulting fragments were TA subcloned using the pGEM T-easy kit (Promega, Madison, WI) and sequenced as described previously
(Nozaki et al. 2006).
Genomic PCR and sequencing of GpMID: Genomic DNA
from the four parental strains (Kaneko3 and -4; Mongolia 4
and 1) and their F1 progeny were prepared either by the
‘‘miniprep’’ method described by Miller et al. (1993) or using
the DNeasy plant mini kit (QIAGEN). For determining the
genomic sequence of GpMID from Kaneko3 and Mongolia 4,
PCR amplification was performed with specific primers for
GpMID (GPMID5P-1F and GPMID3P-1R). The PCR reaction
285
was done using LA Taq DNA polymerase with GC buffer I
(TAKARA) and GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA). PCR products were sequenced
directly or after TA cloning, as described above.
DNA gel blot analysis of GpMID: Southern blot analysis was
done following the protocols of Nishii et al. (2003) modified
to use the nonradioisotope detection system outlined below. Restriction enzyme digests (6 mg) of genomic DNA were
separated by 1.0% agarose gel electrophoresis and transferred
onto a Hybond-N1 membrane (GE Healthcare Bio-Sciences,
Little Chalfont, UK) (Sambrook and Russell 2001) using a
vacuum blotter (Bio-Rad, Hercules, CA). A probe containing
the GpMID ORF region was prepared by PCR with the primer
pair GPMID-5P1F and GpMidR3 using Kaneko3 genomic
DNA as template. The probe was labeled with fluorescein-11dUTP (Gene Images random prime labeling module, GE
Healthcare Bio-Sciences) and hybridized at 68° according to
the manufacturer’s protocol. The signals were detected with
Gene Images CDP-Star detection kit (GE Healthcare BioSciences) and VersaDoc Model 5000 (Bio-Rad). The resulting
image was processed with a median filter (diameter: 1 pixel) in
ImageJ (National Institutes of Health, Bethesda, MD) to
remove random noise produced by long exposure (2 hr).
Comparison of GpMID transcript level: Because the expression of MID genes from C. reinhardtii (Ferris and Goodenough 1997; Lin and Goodenough 2007) and P. starrii
(Nozaki et al. 2006) increased in nitrogen-starved cultures,
expression of GpMID was examined with or without nitrogen
starvation for 18 hr; 105–106 cells of G. pectorale Kaneko3 were
pelleted by centrifugation and resuspended in N-free SVM
(SVM modified by omitting urea and replacing CaNO3 with
CaCl2). Polyadenylated mRNA was extracted from algae using
Dynabeads (Invitrogen) as described in the manufacturer’s
protocol. The GpMID expression was assayed by semiquantitative RT–PCR, using the EF1-like gene as an internal control:
GpMID sense, GPMID_int1F; GpMID antisense, GPMID_int4R;
EF1-like sense, CV_EF1A1-R2; and EF1-like antisense, GpEF1AINT3-R. The PCR reaction was done as follows: 95° for 2 min,
followed by 28 cycles of 95°/15 sec, 63°/30 sec, and 68°/40 sec
using KOD plus DNA polymerase (TOYOBO, Osaka, Japan)
and GeneAmp PCR system 9700.
Phylogenetic analysis of GpMID: Both the C. reinhardtii and
V. carteri genome databases of the Department of Energy’s
Joint Genome Institute (JGI) (http://www.jgi.doe.gov/) were
screened for RWP-RK domain genes by TBLASTN (NCBI)
using the CrMID protein sequence. We identified 15 and 10
predicted RWP-RK domain sequences of C. reinhardtii and
V. carteri, respectively. These numbers do not include the MID
genes because the strains chosen for sequencing—plus and female, respectively—do not possess the MID gene. The computergenerated gene models associated with these RWP-RK domains
were assessed and modified or new models were created when
necessary to ensure, for example, that the RWP-RK domain
was contained in the models that we ultimately annotated on
the JGI websites and to incorporate unpublished cDNA data
where available. For C. reinhardtii, the resulting models were
named RWP1-RWP14; the 15th gene had previously been named
NIT2 (Schnell and Lefebvre 1993). The RWP-RK domain of
RWP12 is located at the N terminus; the initial methionine is
set at the seventh residue of the multiple alignment. Since it
seemed likely that the RWP-RK domain should extend farther
into the 59-region, the DNA sequence neighboring RWP12 was
analyzed by GENSCAN (Burge and Karlin 1997) with the
‘‘organism’’ option as Arabidopsis, and a longer protein was
used for the phylogenetic analysis. The 10 possible RWP-RK
protein sequences from the V. carteri genome were also assessed using GENSCAN. Most of the models from both species
have little or no support from expressed sequence tags and so
286
T. Hamaji et al.
should be viewed as tentative. The 25 gene models above, as
well as CrMID, CiMID, PlestMID, and GpMID, were aligned
using ClustalX (Thompson et al. 1997) with the default option.
The 29 RWP-RK domains of 47 amino acids in length (supplemental Figure 1 at http://www.genetics.org/supplemental/)
were subjected to a maximum-likelihood analysis based on the
Whelan and Goldman (WAG) model (Whelan and Goldman
2001) in PHYML online (Guindon et al. 2005). The robustness
of the result was examined using a bootstrap analysis (Felsenstein 1985) with 500 replications. On the basis of the same
alignment data, a maximum parsimony analysis was performed by PAUP*4.0b10 (Swofford 2003) with a bootstrap
analysis based on 1000 replications of the general heuristic
search using the tree-bisection-reconnection branch-swapping
algorithm. A neighbor-joining analysis (Saitou and Nei 1987)
based on the Jones–Taylor–Thornton ( JTT) model ( Jones
et al. 1992) was also performed by MEGA 4.0 (Tamura et al.
2007) with a bootstrap analysis based on 500 replications.
Phylogenetic trees including subsets of these RWP-RK domains have also been published by Nozaki et al. (2006) and
Lin and Goodenough (2007).
Scoring of genetic markers in the F1 progeny: Mating
phenotype: The mating type of the progeny was determined by
mating tests with the two parental strains to determine with
which parent zygotes were formed. Each F1 was co-inoculated
separately with both parent strains in soil–water medium tubes
and allowed to grow up under constant illumination. If mating
was abundant, a zygote pellicle could be seen after 4–5 days,
but in any case, after 5–7 days the thick-walled, orange-colored
zygotes were readily identifiable by light microscopy even if
only a few percent of the cells had mated. A few progeny failed
to mate with either parent.
ACT and YPT4: The actin (ACT) gene and small G-protein
gene YPT4 (Fabry et al. 1998) were chosen as controls because
they are unlinked to MT in Chlamydomonas and because PCR
primers had been designed previously by Liss et al. (1997)
for amplifying these two genes from Volvocales. On the JGI
Chlamydomonas genome website, these two genes are annotated as IDA5 and RABB1, respectively.
The A/9-59 and A/9-39 primers were used to amplify intron
IX of ACT by PCR from both the Mongolia 1 and 4 strains. The
sequences of these two PCR products were used to design
two nondegenerate primers, gonact1 and gonact2, that PCR
amplify both ACT alleles. That 380-bp PCR product was
double digested with EcoRI (one site in the Mongolia 1 allele,
yielding bands of 180 and 200 bp) and XhoI (one site in the
Mongolia 4 allele, yielding bands of 140 and 240 bp) and
analyzed by agarose gel electrophoresis.
The 4/6-59 and 4/6-39 primers were used to amplify intron
VI of YPT4 by PCR from the Mongolia 1 and 4 strains. The
sequences of these two PCR products were used to design two
nondegenerate primers, gonypt1 and gonypt2, that PCR
amplify both YPT4 alleles. The 360-bp PCR product was
then digested with HinfI and analyzed by agarose gel electrophoresis to visualize the different patterns of bands in the two
strains (in Mongolia 1: 260, 70, and 30 bp; in Mongolia 4: 120,
110, 70, and 60 bp).
PR46a: The PR46a gene is within segment 3 of the sexually
dimorphic R domain of the C. reinhardtii MT loci (Ferris et al.
2002). Its predicted amino acid sequence was used to design
primers for amplifying the PR46a gene from G. pectorale genomic
DNA. PCR of Mongolia 4 genomic DNA using primers pr46for
and pr46rev yielded an 200-bp product, which was TA
subcloned using the pGEM T-easy kit. The gel-purified insert
was radiolabeled with 32P and hybridized at a reduced stringency
(58°) to the PstI-digested genomic DNA Southern blots used to
score chloroplast and mitochondria markers (see below). The
RFLP visualized in Mongolia 1 is 1.0 kb and in Mongolia 4, 1.8 kb.
LEU1S: Identified in the Chlamydomonas genome sequence, the gene encoding the small subunit of isopropylmalate dehydratase (LEU1S; protein ID 126865 in the C.
reinhardtii genome database version 3.0) is found in segment
4 of the sexually dimorphic R domain of the Chlamydomonas
MT loci near the position of probe Pr65 in Ferris et al. (2002).
The G. pectorale LEU1S gene was cloned by screening a
Mongolia 1 genomic EMBL3 library using as probe a 600-bp
ClaI/HindIII fragment (roughly corresponding to the coding
region) purified from a C. reinhardtii LEU1S cDNA clone
(provided by the Kazusa Institute; corresponds to AV388014).
The portion of the phage insert containing the LEU1S gene
was sequenced. To score progeny for the LEU1S marker, a PCR
reaction was performed using primers gonleu13 and gonleu14. The resulting 1050-bp PCR product was then digested
with MfeI and subjected to agarose gel electrophoresis, producing different band patterns in the two alleles (in Mongolia
1: 470 and 580 bp; in Mongolia 4: 360 and 690 bp).
ALB3.1: The ALB3.1 gene, also known in the Chlamydomonas literature as AC29, is 40 kb centromere distal of
the MT locus R domain (Ferris et al. 2002). The G. pectorale
ALB3.1 gene was cloned by screening an Alaska2 genomic
EMBL3 library using a portion of the C. reinhardtii ALB3.1
cDNA as the probe. The portion of the phage insert corresponding to the ALB3.1 gene was sequenced. The predicted
protein product of the G. pectorale gene was clearly more
similar to the C. reinhardtii ALB3.1 gene linked to the matingtype locus than to the unlinked ALB3.2 gene (Bellafiore et al.
2002). To score progeny for the ALB3.1 marker, a PCR reaction was performed using primers gac30 and gac31, and the
350-bp PCR product was then digested with PstI, which cuts
only the Mongolia 1 allele (into 240 and 110 bp), and analyzed
by agarose gel electrophoresis.
MID: To determine the presence or absence of the GpMID
gene in the genome, PCR was carried out with specific primers:
Mong4F1 and Mong4R1 for GpMID. As the internal control,
ACT gene-specific primers gonact1 and gonact2 were used.
Organellar markers: Chloroplast and mitochondrial genomes
from the two parents were scored by taking advantage of
RFLPs. Genomic DNA (500 ng) of the parental and progeny
strains was digested with PstI, electrophoresed on a 0.75%
agarose gel in TBE buffer, and transferred to nitrocellulose.
The blots were hybridized (Church and Gilbert 1984) sequentially with the PR46a probe (see above), the mitochondria probe, and the chloroplast probe, stripping the filters to
remove the previous probe before rehybridizing. The probe
for mitochondrial DNA was the 1.6-kb EcoRI/HindIII fragment of the C. reinhardtii mitochondrial genome, purified
from the P318 plasmid obtained from the Chlamydomonas
Center. Hybridization was carried out at a reduced stringency:
60° rather than the usual 65°.
To visualize chloroplast DNA, a section of the G. pectorale
psaA gene (AB044242) was PCR amplified using Alaska2 genomic DNA as template with primers gonpsa1 and gonpsa2.
The 850-bp PCR product was used as probe at normal stringency (65°). All probes were radiolabeled with ½a-32PdCTP by
random priming.
RESULTS
Identification and characterization of GpMID: Differential nested RT–PCR using cDNA prepared from
‘‘sexually activated cultures’’ of Kaneko3 (minus) and -4
(plus) displayed a fragment of the expected length for
MID orthologs (149 bp) only in Kaneko3. The fulllength cDNA sequence indicated that the mRNA is 1.5–
1.6 kb in length. The predicted open reading frame
Mating-Type Locus in Gonium
287
Figure 1.—Alignment of four MID proteins
from G. pectorale (GpMID), P. starrii (PlestMID),
C. reinhardtii (CrMID), and C. incerta (CiMID).
Solid and shaded backgrounds indicate identity
in 100% or in 75% of the sequences aligned, respectively. Five amino acids composing a leucine
zipper are marked with asterisks. A line marks the
RWP-RK domain of 47 amino acids used for the
phylogenetic analyses (Figure 5).
encodes 164 amino acids; the hypothetical molecular
weight is 18 kDa; the theoretical pI is 9.25. The
hypothetical polypeptide sequence contains a leucine
zipper and an RWP-RK domain near the C terminus
(Figure 1). A BLASTP search (http://www.ncbi.nih.gov/)
with this sequence indicated that it is similar to PlestMID
(E ¼ 5e-46), CiMID (E ¼ 4e-28), and CrMID (E ¼ 2e-27).
The percentage of identity of GpMID protein with
CrMID, CiMID, and PlestMID is 38.4, 38.4, and 53.3,
respectively. A BLASTN search (http://www.ncbi.nih.
gov/) using an expect threshold of 10 and a word size
of 11 with the GpMID cDNA sequence found matches
with PlestMID but none with CrMID or CiMID. The coding region is 52.9% GC and the primary transcript is
51.4% GC.
The genomic GpMID gene sequenced in this study
(1603 bp) covered nearly the entire cDNA sequence and
demonstrated that it contains four introns, three of
which are in positions very similar to those of the three
Figure 2.—Exon–intron structure of MID genes from G.
pectorale (GpMID), P. starrii (PlestMID), C. reinhardtii (CrMID),
and C. incerta (CiMID). Corresponding parts of the coding regions (CDS) are interconnected by dotted lines. The line displayed above GpMID indicates the region used as a probe for
the DNA gel blot analysis.
introns that are present in the CrMID and CiMID genes,
and all four are shared with PlestMID (Figure 2).
A genomic DNA gel blot analysis of restrictiondigested plus and minus DNA probed with a PCR fragment of GpMID demonstrated a minus-specific single
band (Figure 3), indicating that GpMID is a single-copy
gene in minus (Kaneko3). The lack of hybridizing signal
in the plus strain (Kaneko4) suggests genomic asymmetry between mating types. A similar result was observed
with Mongolia 1 and 4 strains; the signal was detected
not from Mongolia 1 (plus) but from Mongolia 4 (minus;
data not shown). This conclusion was confirmed when
specific GpMID primers were used to perform PCR with
DNA samples from plus and minus F1 progeny derived
from Kaneko3 3 -4, consistent with their mating phenotypes (data not shown). These results clearly suggest
that the mating type minus of G. pectorale correlates with
the presence of GpMID.
Semiquantitative RT–PCR with the GpMID cDNAspecific primers showed that GpMID transcription was
upregulated in nitrogen-free culture (Figure 4). The
mating reaction commenced immediately after mixing
the two complementary mating types when the cells
were nitrogen starved for 18 hr, whereas no mating
reaction occurred within 24 hr after mixing of cells cultured in SVM. These observations suggest that expression of GpMID increased in minus gametes induced by
nitrogen starvation.
Phylogenetic analysis of genes containing the conserved RWP-RK domain: To confirm that GpMID is
orthologous to the MID genes, a phylogenetic analysis
was carried out using the alignment of four MID proteins and 25 other RWP-RK domains of C. reinhardtii and
V. carteri. As shown in Figure 5, the four MID proteins
formed a robust monophyletic group (with 74–91%
bootstrap values). Within the MID clade, GpMID and
PlestMID are sister to each other with 81–99% bootstrap
values. Similar results were reported by Lin and Goodenough (2007) using a smaller set of genes.
288
T. Hamaji et al.
Figure 4.—Semiquantitative RT–PCR analysis of GpMID.
The Kaneko3 strain was cultured either in nitrogen-free
SVM (N-free SVM) for 18 hr or in ordinary SVM. Poly(A)1
RNA from these cultures was reverse transcribed and PCR amplified using primers for GpMID and for the EF1-like gene,
which served as an internal control.
Figure 3.—GpMID is present only in MT. Genomic DNA isolated from a minus strain, Kaneko3 (labeled ‘‘’’ below the gel)
and a plus strain, Kaneko4 (labeled ‘‘1’’), was digested with either SacII or PstI and hybridized with the GpMID probe whose
location is shown in Figure 2. Size standards are shown on the
left. GpMID is detected as a single band only in the minus strain.
Nuclear and organellar genetics: The bulk of the genetic mapping data was generated using 78 progeny of a
single cross between Mongolia 1 and 4 (Tables 2 and 3;
Figures 6–8). Another 20 progeny were eliminated from
further analysis after being scored with only the ACT
marker because they contained both parental alleles
and either were diploid/aneuploid or were not properly
subcloned. As shown in Table 2, recovery of the alleles
for some of the markers deviates from 1:1 in several
cases, especially YPT4.
Six nuclear genes were scored by taking advantage of
sequence polymorphisms between the parental strains.
Since this is the first G. pectorale genetic analysis and
G. pectorale is not routinely in laboratory use, it was important to ensure that the progeny were indeed products
of meiosis and not, for example, unmated gametes that
had somehow survived freezing. Hence, two genes (ACT
and YPT4) that are not expected to be MT linked (Ferris
et al. 2002) were chosen as controls to confirm independent segregation of unlinked markers. The remaining
four markers are all linked to the MT locus in C. reinhardtii
(Ferris and Goodenough 1994, Ferris et al. 2002):
three (LEU1S, PR46a, and MID) are in the dimorphic R
domain of the MT locus, and one (ALB3.1) is located just
centromere distal of the R domain. The mating phenotype was also scored to be either plus or minus.
Figure 6 shows a representative DNA–DNA gel blot
and AFLP analyses used to score the nuclear markers in
the F1 progeny, and Figure 7 shows the genotype of
the entire set of progeny. Table 3 shows, for each pair of
markers, the proportion of progeny that are recombinant. As anticipated, the ACT and YPT4 genes are not
linked to each other or to any other marker. However,
the LEU1S gene was strictly linked to mating type. The
PR46a and ALB3.1 genes are loosely linked to each
other, recombining in only 12 of 77 progeny, a map
distance of 16 cM (Table 3), but are not linked to mating
type. The presence of GpMID is strictly linked to having a
minus mating phenotype; no GpMID was found in plus
progeny.
Of the 20 progeny strains that showed both alleles of
the ACT marker, 3 were resubcloned and proved to have
both alleles for all nuclear markers, as well as the GpMID
marker, and hence are likely diploid (Figure 6). All
three of them mated with the plus parent. Therefore,
the dominant mating type of G. pectorale is minus.
The direction of uniparental inheritance was tested
in the F1 progeny as well. Radiolabeled probes to the
chloroplast and mitochondrial DNA were hybridized to
Southern blots of PstI-digested DNA from parents and
progeny. The 11-kb chloroplast DNA fragment from the
plus parent was inherited in 66 progeny (UP1), while
only 5 progeny inherited the 2.8-kb fragment of the
minus parent (Figure 8A). Seven progeny showed a band
of 20 kb not present in either parent, either in conjunction with the 11-kb band (5 progeny, one of which is
shown in Figure 8A) or as the sole band (2 progeny).
Perhaps this represents a polymorphism that appeared
in a subpopulation of the plus parent strain after the
DNA preparation was made. We chose to score these 7
progeny as having inherited from the plus parent.
Seventy progeny inherited exclusively the 7-kb mitochondrial DNA fragment from the minus parent (UP),
while the 10-kb fragment from the plus parent was inherited in only a single progeny (Figure 8B, top). Seven
progeny were biparental, but the Mongolia 4 (minus)type band predominated (e.g., the fourth progeny in
Figure 8B, top).
Mating-Type Locus in Gonium
289
Figure 5.—Maximum-likelihood (ML) tree
(based on WAG model) of four MID proteins
and 25 RWP-RK domains from C. reinhardtii
(Cr) and V. carteri (Vc) genome databases.
Branch lengths are proportional to the estimated
amino acid substitutions, which are indicated by
the scale bar above the tree. Numbers to the left
of branch points indicate bootstrap values of the
ML, neighbor-joining (based on the JTT model),
and maximum parsimonious analyses, respectively, of the same data matrix and are included
only if the value is $50%. Only CrNIT2 and the
MID genes are characterized.
As a control for the possibility that a replication
advantage of the mitochondrial DNA from the Mongolia 4 parent might be mistaken for uniparental inheritance, the single progeny (marked as P2 in both panels
of Figure 8B) that was minus with a Mongolia 1 (plus)type mitochondrial genome was crossed with another F1
progeny (lane P1 in the bottom of Figure 8B) that was
plus and had inherited the Mongolia 4 mitochondrial
DNA. All 12 progeny inherited the mitochondrial DNA
of the minus parent (P2), which in this cross was the
Mongolia 1 allele. The 12 F2 progeny were also tested for
segregation of several nuclear markers to ensure that
they were indeed meiotic progeny (not shown).
DISCUSSION
GpMID is an ortholog of CrMID: The structure of
GpMID is essentially consistent with that of the other
MID orthologs, CrMID, CiMID, and PlestMID (Ferris
and Goodenough 1997; Ferris et al. 1997; Nozaki et al.
2006). They have the homologous RWP-RK domain, the
putative bZIP DNA-binding region containing the regularly repeated hydrophobic amino acids (Figure 1).
Moreover, the present phylogenetic analysis clearly
demonstrates that all four MID genes form a robust
monophyletic group relative to other RWP-RK domaincontaining genes in C. reinhardtii and V. carteri (Figure
5). Although the GpMID protein sequence shows sim-
TABLE 2
TABLE 3
Ratio of parental alleles in the progeny for each locus
Fraction of progeny recombinant for each pair of markers
Locus
ACT
YPT4
ALB3.1
PR46a
LEU1S/MID
Mating type
No. of
No. of
progeny
progeny
with
with
Ratio of
Mongolia 1 Mongolia 4
allele
Mongolia1:Mongolia 4
allele
44
26
38
46
36
33
34
52
40
31
42
36
1.3:1
0.5:1
0.95:1
1.5:1
0.86:1
0.92:1
ACT
ACT
YPT
ALB3.1
PR46a
LEU1S
MID
Mating
type
—
YPT
ALB3.1 PR46a LEU1S
42/78 36/78 39/77
—
38/78 37/77
—
12/77
—
48/78
40/78
40/78
44/77
—
MID
48/78
40/78
40/78
44/77
0/78
—
Mating
type
42/69
35/69
38/69
39/68
0/69
0/69
—
290
T. Hamaji et al.
Figure 6.—Scoring the nuclear markers in
the F1 progeny. A sampling of the DNA gel blot
and PCR–RFLP analyses on G. pectorale progeny
strains for the six nuclear markers. Diploid strains
are marked with asterisks. Parental strains were
Mongolia 1 (M1) and Mongolia 4 (M4). Size
markers (in base pairs) are indicated to the right.
The panels do not display the same sets of progeny. The presence/absence of MID (top band) is
shown with ACT as an internal control (bottom
band).
ilarity to the other three MID orthologs, the present
analysis using the nucleotide sequence (BLASTN of
NCBI) could not find significant matches between
GpMID and the two MID orthologs of Chlamydomonas,
consistent with the fact that Ferris et al. (1997) could
not detect any MID signal in G. pectorale by the lowstringency DNA gel blot analysis. As with CrMID and
PlestMID (Ferris and Goodenough 1997; Nozaki et al.
2006), GpMID is a mating-type-specific gene that is expressed in nitrogen-starved cultures of minus/male
Figure 7.—A complete representation of which alleles were inherited in the set of G. pectorale F1 progeny examined. Shaded boxes
indicate inheritance of the phenotype (mating type: MT) or genotype (chlp, chloroplast; mito, mitochondria) of the plus parent ½M1
(MT1); open boxes indicate the minus parent ½M4 (MT). A circle within a square indicates that the mating phenotype was not
observed, or there were no data. A half-shaded/half-open square indicates biparental transmission of mitochondrial markers.
Mating-Type Locus in Gonium
Figure 8.—Uniparental inheritance of organellar genomes
in progeny of G. pectorale crosses. (A) Genomic DNA of the
two parent strains (Mongolia 1 and 4, M1 and M4, respectively) and 11 F1 progeny were digested with PstI, and the resulting Southern blot was hybridized with a portion of the G.
pectorale psaA gene to visualize chloroplast DNA. (B) (Top) Genomic DNA of the two parent strains (M1 and M4) and 11
progeny were digested with PstI, and the resulting Southern
blot was hybridized with a portion of the C. reinhardtii mitochondrial genome to visualize mitochondrial DNA. One of
the parents (P2) used in a second cross is indicated. (Bottom)
Parents and progeny of an F2 cross using F1 progeny P1 and
P2 as parents. Positions of size markers (in kilobases) are indicated at the right.
strains. In both DNA gel blot analysis and genomic PCR,
GpMID was detected in minus strains, but not in plus
(Figures 3 and 7). An increase in expression of GpMID
was detected by RT–PCR in nitrogen-starved cultures of
minus (Figure 4). PlestMID, the MID ortholog from P.
starrii, was shown to be localized in the sperm (male
gamete) nucleus by immunofluorescent microscopy
(Nozaki et al. 2006). Therefore, GpMID is supposed
to be functional in the nucleus of the G. pectorale minus
gamete.
Diploid progeny from Mongolia 1 (plus) and Mongolia 4 (minus) exhibited a minus phenotype. C. reinhardtii
diploids also exhibit this minus dominance (Ebersold
1967), which is the result of the presence of the MID
gene (Ferris and Goodenough 1997). The GpMID
gene presumably makes minus the dominant mating
type in G. pectorale. Transformation of GpMID DNA into a
G. pectorale plus strain would confirm this point but has
not been performed because there is no stable transformation method in G. pectorale. Recently, however, the
highly efficient transgenic method in C. reinhardtii has
291
been applied to the colonial volvocalean algae (Sizova
et al. 2001; Jakobiak et al. 2004; Hallmann and Wodniok
2006). This transgenic approach may be available in G.
pectorale to examine the GpMID function in the plus strain.
Regulation of the TMS formation might have changed
in the course of evolution: In C. reinhardtii, gametes of
only one of the two mating types, plus, bear TMS, but
mid-1, the CrMID-defective mutant of the minus strain,
forms a TMS, suggesting that CrMID directly or indirectly suppresses the formation of TMS (Goodenough
et al. 1982; Ferris and Goodenough 1997; Lin and
Goodenough 2007). However, gametes of both mating
types of G. pectorale form TMS (Nozaki 1984), whereas
GpMID is present only in minus genomes (Figure 3).
Therefore, G. pectorale may be different from C. reinhardtii
in that its MID gene (or a downstream MID responsive
gene) may not suppress formation of TMS. Because G.
pectorale and the anisogamous/oogamous alga P. starrii
(Nozaki et al. 2006) have MID orthologs that are matingtype-specific as in C. reinhardtii (Ferris and Goodenough
1997), the mating-type-specific feature of MID orthologs
seems to be conservative within the colonial Volvocales.
In addition, almost all of the isogamous colonial Volvocales (Gonium, Astrephomene, Pandorina, Volvulina, and
Yamagishiella) have TMS in each of the two conjugating
gametes, and this type of TMS might have evolved from
TMS as found in C. reinhardtii (Nozaki and Itoh 1994;
Nozaki et al. 2000). Therefore, the loss of suppression of
TMS formation as suggested in the GpMID contol pathway
might have evolved in the common ancestor of these
members of the colonial Volvocales, possibly at an early
evolutionary stage (a four- to eight-celled colonial stage)
within the colonial Volvocales (Nozaki and Itoh 1994;
Nozaki et al. 2000).
Nuclear genetics suggests dynamic reorganization in
the MT locus: On the basis of this genetic analysis of
G. pectorale F1 progeny, the LEU1S gene and presence/
absence of GpMID are strictly linked to mating phenotypes (Table 3; Figure 7). In contrast, the other four
nuclear genes (PR46a, ACT, YPT4, and ALB3.1) are genetically independent of plus or minus in G. pectorale,
although ALB3.1 and PR46a are located 16 cM apart. We
suggest that GpMID and LEU1S are likely harbored in a
chromosomal region of recombinational suppression
that is comparable to the C. reinhardtii MT locus, although this linkage could also be explained if the two
genes are close together—they are only 50 kb apart in
Chlamydomonas. In C. reinhardtii, two genes (ACT and
YPT4) are also not MT linked (Ferris et al. 2002)
whereas all four remaining markers are linked to MT in
C. reinhardtii (Ferris and Goodenough 1994; Ferris
et al. 2002): one centromere distal of the R domain
(ALB3.1) and the remaining three (LEU1S, PR46a, and
CrMID) in the R domain. Therefore, gene rearrangement within and around the MT locus must have occurred during the evolution from the common ancestor
of C. reinhardtii and G. pectorale. Whether the PR46a and
292
T. Hamaji et al.
ALB3.1 genes have relocated to another chromosome
or to a more distant location on the same chromosome
is not yet determined.
One of the unusual features of the MID genes is the
relatively low GC content (GpMID: 52.9%; PlestMID:
49.1%; CrMID: 50.5%; CiMID: 49.4%). GC content of
coding regions is high in C. reinhardtii (68%; Merchant
et al. 2007) and in C. incerta (64.7%; Popescu et al. 2006)
and, although based only on the two gene sequences
(ALB3.1 and LEU1S) reported here (68.5%), G. pectorale
may be similar. The GC content of MID is low in the
introns and UTRs as well. In Ferris et al. (2002), it was
suggested that the low GC content of both MID and
FUS1 (which exists only in the MT1 locus; Ferris et al.
1996) could result from being restricted to only one MT
locus over evolutionary time periods. One possible
mechanism consistent with this idea is ‘‘biased gene
conversion toward GC’’ (BGCGC; reviewed in Marais
2003). In the BGCGC scheme, when recombination or
gene conversion occurs, repair mechanisms tend to
replace the mismatches in the resulting DNA heteroduplexes toward G or C; recombination rate correlates
with the GC content in yeast, invertebrate, and mammalian genomes. The MID gene never undergoes recombination since it is hemizygous in the diploid stage
and would escape biased conversion, accounting for the
lower GC content over both coding and noncoding
sequences. Since MID has been conserved throughout
the Volvocales (being present also in the V. carteri male
mating type; P. J. Ferris, T. Hamaji, I. Nishii and H.
Nozaki, unpublished results), it would have been subject to BGCGC for at least 50 MY (Kirk 2005). The lower
GC content of Y-specific genes in humans has been
postulated to be the result of BGCGC as well (Galtier
et al. 2001).
Biased gene conversion can also explain the similarly
low GC content (47.7%) of FUS1; however, no orthologs
of FUS1 have been characterized, so there is no information on how long FUS1 has been restricted to only
one mating type. Three additional genes in the C.
reinhardtii MT loci—MTA1, EZY2, and MTD1—are
sexually dimorphic but have coding-region GC contents
typical for C. reinhardtii (65, 68, and 68%, respectively).
The MT1 locus-specific MTA1 appears to have been
created within a recent duplication from another chromosome (Ferris et al. 2002). Hence, MTA1 likely exists
only in C. reinhardtii, and there has been only limited
time for BGCGC to affect this sequence. The EZY2 gene
is a tandemly repeated gene in the MT1 locus, but this is
also likely a recent event, with a single well-conserved
(albeit pseudogene) copy of EZY2 still present in MT
(Ferris et al. 2002). In addition, BGCGC can occur via
the mechanisms responsible for concerted evolution in
tandem arrays (Galtier et al. 2001). No orthologs of
the EZY2 gene have been identified. Finally, MTD1 is
limited to the MT locus (Ferris et al. 2002; Lin and
Goodenough 2007). Although its coding region has a
typical GC content, its noncoding sequences (introns
plus UTRs) have a GC content of only 54% (P. J. Ferris
and J. Umen, unpublished results), while the G. pectorale
ortholog is 55.5% GC coding, and 50.2% GC noncoding
(T. Hamaji, P. J. Ferris, I. Nishii and H. Nozaki,
unpublished results). The amino acid composition of
the C. reinhardtii MTD1 is biased toward GC-rich codons,
suggesting that other selection pressures on the GC
content of the coding region may obscure the effect of
BGCGC.
Organellar inheritance between isogamy and anisogamy/oogamy might have changed: In C. reinhardtii, the
uniparental inheritance of organellar genomes differs
in plastids and mitochondria (Boynton et al. 1987).
The plastid genome in F1 progeny is usually transmitted
from the plus parent whereas the mitochondrial DNA
of the progeny is from the parental minus, which has
CrMID. The mode of uniparental inheritance of plastid
and mitochondrial genomes in G. pectorale is UP1 and
UP, respectively (Table 3), the same as that of C.
reinhardtii. However, both the chloroplast and mitochondrial genomes are transmitted from the female
parent in the oogamous V. carteri (Adams et al. 1990).
Both V. carteri and its close relative P. starrii have the
MID ortholog (PlestMID) in the male strains (Nozaki
et al. 2006 and P. J. Ferris, T. Hamaji, I. Nishii and
H. Nozaki, unpublished results), suggesting that the
male in the anisogamous/oogamous volvocaleans evolved
from the MID-containing, minus mating type of C.
reinhardtii (Nozaki et al. 2006). Therefore, the uniparental inheritance of the mitochondrial genome has
changed at some point during the evolution of the
colonial Volvocales from uniparentally from the MIDcontaining (minus) parent to uniparentally from the
female, which does not carry MID.
Conclusion: This characterization of the minusspecific gene GpMID and analyses of F1 progeny suggested
that GpMID and LEU1S are harbored in a chromosomal
region under recombinational suppression that is comparable to the C. reinhardtii MT locus, which consists of
a 1-Mb region of recombinational suppression and
harbors several mating-type-specific genes (Ferris and
Goodenough 1994; Ferris et al. 2002); the linkage of
the two genes could also be explained by their close
proximity (e.g., within 50 kb in Chlamydomonas). Nozaki
et al. (2006) demonstrated that PlestMID and its pseudogene PsPlestMID in the anisogamous colonial volvocalean
P. starrii are also mating type (male) specific and have
neutral GC contents that may represent suppression of
recombination in the regions of the two genes. Therefore,
the presence of a MT locus under recombinational suppression may be conserved within the isogamous and
anisogamous/oogamous members of the colonial Volvocales. However, these genetic analyses of G. pectorale demonstrated that chromosomal rearrangement including
the MT locus must have occurred during the evolution
from the common ancestor of C. reinhardtii and G. pectorale.
Mating-Type Locus in Gonium
Genomic analyses of MT loci using BAC libraries from
colonial Volvocales including G. pectorale and P. starrii
will resolve important gene changes in the MT loci during
the evolution of TMS and the origin of female and male
within this model lineage of ‘‘sex evolution.’’
We thank Linda Small for her technical support and Ursula
Goodenough and Jim Umen for their encouragement. The C.
reinhardtii sequence data were produced by the U. S. Department of
Energy Joint Genome Institute (http://www.jgi.doe.gov/). The V.
carteri genome sequencing work was performed by the Joint Genome
Institute under the auspices of the U. S. Department of Energy’s Office
of Science, Biological and Environmental Research Program and the
University of California, Lawrence Livermore National Laboratory,
under contract no. W-7405-ENG-48; Lawrence Berkeley National Laboratory under contract no. DE-AC03-76SF00098; and Los Alamos
National Laboratory under contract no. W-7405-ENG-36; and was
provided for use in this publication only. This work was supported by a
Grant-in-Aid for Creative Scientific Research (no. 16GS0304 to H.N.);
by a Grant-in-Aid for Scientific Research (no. 17370087 to H.N.) from
the Ministry of Education, Culture, Sports, Science and Technology,
Japan; by the Japan Society for the Promotion of Science (nos. S05750
and L06701 to P.J.F.); and by the National Science Foundation (no.
9904667).
LITERATURE CITED
Adams, C. R., K. A. Stamer, J. K. Miller, J. G. McNally, M. M. Kirk
et al., 1990 Patterns of organellar and nuclear inheritance
among progeny of two geographically isolated strains of Volvox
carteri. Curr. Genet. 18: 141–153.
Bellafiore, S., P. Ferris, H. Naver, V. Göhre and J. D. Rochaix,
2002 Loss of Albino3 leads to the specific depletion of the
light-harvesting system. Plant Cell 14: 2303–2314.
Boynton, J. E., E. H. Harris, B. D. Burkhart, P. M. Lamerson and
N. W. Gillham, 1987 Transmission of mitochondrial and chloroplast genomes in crosses of Chlamydomonas. Proc. Natl. Acad.
Sci. USA 84: 2391–2395.
Burge, C., and S. Karlin, 1997 Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268: 78–94.
Church, G. M., and W. Gilbert, 1984 Genomic sequencing. Proc.
Natl. Acad. Sci. USA 81: 1991–1995.
Ebersold, W. T., 1967 Chlamydomonas reinhardi: heterozygous diploid strains. Science 157: 447–449.
Fabry, S., A. Köhler and A. W. Coleman, 1998 Intraspecies analysis: comparison of ITS sequence data and gene intron sequence
data with breeding data for a worldwide collection of Gonium pectorale. J. Mol. Evol. 48: 94–101.
Felsenstein, J., 1985 Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791.
Ferris, P. J., and U. W. Goodenough, 1994 The mating-type locus
of Chlamydomonas reinhardtii contains highly rearranged DNA sequences. Cell 76: 1135–1145.
Ferris, P. J., and U. W. Goodenough, 1997 Mating type in Chlamydomonas is specified by mid, the minus-dominance gene. Genetics
146: 859–869.
Ferris, P. J., J. P. Woessner and U. W. Goodenough, 1996 A sex
recognition glycoprotein is encoded by the plus mating-type gene
fus1 of Chlamydomonas reinhardtii. Mol. Biol. Cell 7: 1235–1248.
Ferris, P. J., C. Pavlovic, S. Fabry and U. W. Goodenough,
1997 Rapid evolution of sex-related genes in Chlamydomonas.
Proc. Natl. Acad. Sci. USA 94: 8634–8639.
Ferris, P. J., E. V. Armbrust and U. W. Goodenough, 2002 Genetic
structure of the mating-type locus of Chlamydomonas reinhardtii.
Genetics 160: 181–200.
Gachon, C. M. M., J. G. Day, C. N. Campbell, T. Pröschold, R. J.
Saxon et al., 2007 The Culture Collection of Algae and Protozoa (CCAP): a biological resource for protistan genomics.
Gene 406: 51–57.
Galtier, N., G. Piganeau, D. Mouchiroud and L. Duret, 2001 GCcontent evolution in mammalian genomes: the biased gene conversion hypothesis. Genetics 159: 907–911.
293
Goodenough, U. W., P. A. Detmers and C. Hwang, 1982 Activation for cell fusion in Chlamydomonas: analysis of wild-type gametes and nonfusing mutants. J. Cell Biol. 92: 378–386.
Guindon, S., F. Lethiec, P. Duroux and O. Gascuel, 2005 PHYML
Online: a web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids Res. 33: W557–W559.
Hallmann, A., and S. Wodniok, 2006 Swapped green algal promoters: aphVIII-based gene constructs with Chlamydomonas flanking sequences work as dominant selectable markers in Volvox and
vice versa. Plant Cell Rep. 25: 582–591.
Harris, E. H., 1989 The Chlamydomonas Sourcebook. Academic
Press, San Diego.
Jakobiak, T., W. Mages, B. Scharf, P. Babinger, K. Stark et al.,
2004 The bacterial paromomycin resistance gene, aphH, as a
dominant selectable marker in Volvox carteri. Protist 155: 381–393.
Jones, D. T., W. R. Taylor and J. M. Thornton, 1992 The rapid
generation of mutation data matrices from protein sequences.
Comput. Appl. Biosci. 8: 275–282.
Karol, K. G., R. M. McCourt, M. T. Cimino and C. F. Delwiche,
2001 The closest living relatives of land plants. Science 294:
2351–2353.
Kasai, F., M. Kawachi, M. Erata and M. M. Watanabe (Editors),
2004 NIES-Collection. List of Strains. Microalgae and Protozoa, Ed.
7. National Institute for Environmental Studies, Tsukuba, Japan.
Kirk, D. L., 2005 A twelve-step program for evolving multicellularity
and a division of labor. BioEssays 27: 299–310.
Lin, H, and U. W. Goodenough, 2007 Gametogenesis in the Chlamydomonas reinhardtii minus mating type is controlled by two
genes, MID and MTD1. Genetics 176: 913–925.
Liss, M., D. L. Kirk, K. Beyser and S. Fabry, 1997 Intron sequences
provide a tool for high-resolution phylogenetic analysis of volvocine algae. Curr. Genet. 31: 214–227.
Marais, G., 2003 Biased gene conversion: implications for genome
and sex evolution. Trends Genet. 19: 330–338.
Merchant, S. S., S. E. Prochnik, O. Vallon, E. H. Harris, S. J.
Karpowicz et al., 2007 The Chlamydomonas genome reveals
the evolution of key animal and plant functions. Science 318:
245–250.
Miller, S. M., R. Schmitt and D. L. Kirk, 1993 Jordan, an active
Volvox transposable element similar to higher plant transposons.
Plant Cell 5: 1125–1138.
Nishii, I., S. Ogihara and D. Kirk, 2003 A kinesin, InvA, plays an
essential role in Volvox morphogenesis. Cell 113: 743–753.
Nozaki, H., 1984 Newly found facets in the asexual and sexual reproduction of Gonium pectorale (Chlorophyta, Volvocales). Jpn. J.
Phycol. 32: 130–133.
Nozaki, H., and M. Itoh, 1994 Phylogenetic relationships within
the colonial Volvocales (Chlorophyta) inferred from cladistic
analysis based on morphological data. J. Phycol. 30: 353–365.
Nozaki, H., M. Itoh, R. Sano, H. Uchida, M. M. Watanabe et al.,
1995 Phylogenetic relationships within the colonial Volvocales
(Chlorophyta) inferred from rbcL gene sequence data. J. Phycol.
31: 970–979.
Nozaki, H., M. Ito, M. M. Watanabe, H. Takano and T. Kuroiwa,
1997 Phylogenetic analysis of morphological species of Carteria
(Volvocales, Chlorophyta) based on rbcL gene sequences. J. Phycol. 33: 864–867.
Nozaki, H., K. Misawa, T. Kajita, M. Kato, S. Nohara et al.,
2000 Origin and evolution of the colonial volvocales (Chlorophyceae) as inferred from multiple, chloroplast gene sequences.
Mol. Phylogenet. Evol. 17: 256–268.
Nozaki, H., T. Mori, O. Misumi, S. Matsunaga and T. Kuroiwa,
2006 Males evolved from the dominant isogametic mating type.
Curr. Biol. 16: R1018–R1020.
Popescu, C. E., T. Borza, J. P. Bilawski and R. W. Lee, 2006 Evolutionary rates and expression level in Chlamydomonas. Genetics
172: 1567–1576.
Pringsheim, E. G., 1946 Pure Cultures of Algae. Cambridge University
Press, Cambridge, UK.
Rokas, A., D. Krüger and S. B. Carroll, 2005 Animal evolution
and the molecular signature of radiations compressed in time.
Science 310: 1933–1938.
Saitou, N., and M. Nei, 1987 The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:
406–425.
294
T. Hamaji et al.
Sambrook, J., and D. Russell, 2001 Molecular Cloning: A Laboratory
Manual, Ed. 3. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
Schauser, L., A. Roussis, J. Stiller and J. Stougaard, 1999 A
plant regulator controlling development of symbiotic root nodules. Nature 402: 191–195.
Schauser, L., W. Wieloch and J. Stougaard, 2005 Evolution of
NIN-like proteins in Arabidopsis, rice, and Lotus japonicus. J.
Mol. Evol. 60: 229–237.
Schnell, R. A., and P. A. Lefebvre, 1993 Isolation of the Chlamydomonas regulatory gene NIT2 by transposon tagging. Genetics
134: 737–747.
Schreiber, E., 1925 Zur Kenntnis der Physiologie und Sexualität
höherer Volvocales. Zeitschr. Bot. 17: 337–376.
Sizova, I., M. Fuhrmann and P. Hegemann, 2001 A Streptomyces rimosus aphVIII gene coding for a new type phosphotransferase
provides stable antibiotic resistance to Chlamydomonas reinhardtii.
Gene 277: 221–229.
Starr, R. C., 1969 Structure, reproduction, and differentiation of
Volvox carteri f. nagariensis Iyengar, strains HK 9 and 10. Arch. Protistenkunde 111: 204–222.
Stein, J. R., 1958 A morphologic and genetic study of Gonium pectorale. Am. J. Bot. 45: 664–672.
Swofford, D. L., 2003 PAUP*. Phylogenetic Analysis Using Parsimony
(*and Other Methods), Version 4.0b10. Sinauer Associates, Sunderland, MA.
Tamura, K., J. Dudley, M. Nei and S. Kumar, 2007 MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol. Biol. Evol. 24: 1596–1599.
Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin and D. G.
Higgins, 1997 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucleic Acids Res. 25: 4876–4882.
Whelan, S., and N. Goldman, 2001 A general empirical model of
protein evolution derived from multiple protein families using a
maximum-likelihood approach. Mol. Biol. Evol. 18: 691–699.
Yamada, T. K., T. Nakada, K. Miyaji and H. Nozaki, 2006 Morphology and molecular phylogeny of Gonium multicoccum (Volvocales, Chlorophyceae) newly found in Japan. J. Jpn. Bot. 81:
139–147.
Communicating editor: S. Dutcher