* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Introduction Aim TE presence/absence variant discovery Abundant
Comparative genomic hybridization wikipedia , lookup
DNA profiling wikipedia , lookup
Behavioral epigenetics wikipedia , lookup
Genomic imprinting wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA polymerase wikipedia , lookup
Oncogenomics wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Genome evolution wikipedia , lookup
Human genome wikipedia , lookup
Metagenomics wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Primary transcript wikipedia , lookup
Genetic engineering wikipedia , lookup
Epigenetic clock wikipedia , lookup
Point mutation wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Epigenetics wikipedia , lookup
DNA methylation wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA vaccination wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Microsatellite wikipedia , lookup
Molecular cloning wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA supercoil wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genomic library wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Designer baby wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Genome editing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Transposable element wikipedia , lookup
Population scale analysis of transposable element mobilization Tim Stuart1, Steven R. Eichten2, Jonathan Cahn1, Justin Borevitz2, Ryan Lister1 ARC Centre of Excellence in Plant Energy Biology, The University of Western Australia (1), The Australian National University (2) Aim R2 R1 + - D -5 -10 coverage TE variants 0 n=4452 n=740 Old n=2108 1 0 0 200 400 600 TE ranks over SNP-SNP median rank 61% of TE variants are not in linkage disequilibrium with surrounding SNPs 1 10 0 ur fe ic se nt at t en es om en G TE 12 1 TE variants associated with DNA methylation changes TE mC correlation Young Mid Old Density 2 1 0 -1 0 1 -1 0 1 -1 0 1 Pearson correlation values (r2) Presence of TE variants is associated with increased DNA methylation >50% DNA methylation level is positively correlated with TE age -2kb mC/C Insertion point FPKM x 104 14 2 Accessions with TE present FPKM >25 x 105 16 3 TE abs pr ent es en t Low 4 * TE FPKM 20 18 r2 0 TE Genic Intergenic Pseudogene TE insertion sites Pericentromeric regions Chromosome arms RNA-seq AT AtR 2G LP 15 18 04 AT 0 2G 15 04 2 High 5 a TE bs pr ent es en t TE pr TE ese ab nt TE se pr nt TE ese ab nt se nt 0 AT2G01360 22 FPKM x 105 FPKM x 105 10 Accessions with TE absent 20 QPT AT2G01350 TE * Activated gene (PPR protein) AT Q 2G PT 01 35 AT 0 2G 01 36 0 * Accessions with TE present Accessions with TE absent ATAtR 2G LP 15 18 04 0 AT 2G 15 04 2 Col-0 TE absent Bl-1 TE present Col-0 TE absent Accessions with TE present RNA-seq Genes Genes AT5TE47175 chr2:165010-169070 QPT AT2G01360 AT2G01350 chr2:6507400-6512770 AtRLP18 AT2G15040 AT2TE26610 AT2G15042 pr TE insertion in gene upstream region AT3TE29460 Mid es Differential gene expression linked to TE variants TE insertion in gene exon Young TE Superfamily 0% +2kb https://github.com/ListerLab/TEPID ab tepid-map TE TE Mapped split reads R2 0 2 43.7 kb Mapped read pairs TE absence identification 5 Insertion point ATCGCTAGCAGCATCAGCATCATTGCTGTAC Superfamily enrichments for TE variants Distal genomic DNA sequence TE TE-SNP linkage Old chr2:9225478 R2 + - 0 H TE insertion identification YAHA Split read alignments ATCGCTAGCAGCATCAGCATCATTGCTGTAC tepid-refine R1 10 +2kb -2kb Read alignments R1 20 Enrichment (%) bowtie2 Unmapped and clipped reads (single end) + - discordant read split read Young 48.9 kb predicted TE insertion point Paired-end short reads 30 Count r2 values (x103) tepid-discover Genomic features DNA DNA/En−Spm DNA/Harbinger DNA/HAT DNA/Mariner DNA/MuDR DNA/Pogo DNA/Tc1 LINE LINE/L1 LTR/Copia LTR/Gypsy RathE1_cons RathE2_cons RathE3_cons RC/Helitron SINE Unassigned FASTQ Abundant novel genetic diversity chr1:18816503 TE presence/absence variant discovery To identify TE presence/absence variants in a population of wild Arabidopsis accessions, and examine the effects of these TE variants upon genome and cellular function U Ss ps ite tre 5’ am U I n TR tro Ex n on D 3 ow ’ U ns TR tre am Ps eu T do E ge ne Transposable element (TE) activity is silenced through DNA methylation A large fraction of genetic differences between individuals is due to TE presence/absence variants It is challenging to identify TE presence/absence variants from short read DNA sequencing data % with TE variant Introduction 0 Dual Fertilization Anther Petal Central cell Stigma Carpel Sepal Arabidopsis flower Ovule 0 20 40 60 80 100 %TEs absent other lines Egg 4 p <1x10-4 n = 937 2 0 0 20 40 60 80 100 %TEs absent other lines 20 40 60 80 100 %TEs absent other lines Endosperm hypo CG−DMR p <1x10 n = 953 4 -4 0 20 40 60 80 100 %TEs absent other lines Sperm-demethylated TEs are often absent from non-Col-0 accessions and are responsible for more unique TE insertions in the population 2 1 -0 ol C r Le C C x -0 ol C ol C -0 vi x x r Le rx 50 vi ol Le0 rx C vi x vi 100 C 3 0 2 0 4 mCG mCHH 150 Le 1 0 Sperm cell hypo CHH−DMR Frequency x103 Sperm cells Vegetative cell p = 0.1034 n = 407 3 2 * * 200 0 −50 −100 Absence of a TE in the maternal genome leads to demethylation of the paternal copy in the embryo -- -♂ ♀- Parental genome containing TE Embryo mC levels for sperm mCHH-demethylated TEs ∆ mC/C relative to Col−0 x Col−0 (%) Seed Pollen 0 Frequency x103 Vegetative cell nucleus p = 0.0926 n = 109 5 Cvi, n=777 Ler, n=592 p > 0.02 p < 1.4 x 10-10 C Embryo 2 Embryo hyper CHH−DMR Frequency x103 Frequency x103 Sperm cell hyper CG−DMR Whole seed 21−24 nt smRNA abundance Microspore Sperm cell Microspore Sperm cell Embryo Endosperm All TEs Endosperm Transposition frequencies * * 6 Unique TE insertions Frequency that differentially methylated TEs are absent from non-Col-0 genomes ∆ smRNA relative to Col-0 x Col-0 (%) Parental differences in genomic TE content associated with DNA demethylation in hybrid progeny 40 Cvi x Col-0 Col-0 x Cvi 20 ** * mCG mCHG mCHH ** 0 −20 −40 -♂ ♀- Parental genome containing TE References Population DNA sequencing, RNA-seq and WGBS data: Schmitz, R. J. et al. Patterns of population epigenomic diversity. Nature 495, 193–198 (2013). Whole seed smRNA data, embryo DNA methylation data: Pignatta, D. et al. Natural epigenetic polymorphisms lead to intraspecific variation in Arabidopsis gene imprinting. eLife 3, e03198 (2014). Pollen differentially methylated regions: Calarco, J. P. et al. Reprogramming of DNA Methylation in Pollen Guides Epigenetic Inheritance via Small RNA. Cell 151, 194–205 (2012). Embryo and endosperm differentially methylated regions: Hsieh, T. F. et al. Genome-Wide Demethylation of Arabidopsis Endosperm. Science 324, 1451–1454 (2009). DNase I hypersensitivity data: Sullivan, A. M. et al. Mapping and dynamics of regulatory DNA and transcription factor networks in A. thaliana. Cell 8, 2015–2030 (2014). find out more timoast.github.io/lorne2016