Download Slide 1

So, where were we?
• The risk of getting skin cancer, particularly
melanoma, can be reduced by taking
precautions in the sun.
• In this workshop we will focus more on the
association between disease and genes.
• Scientists have found three possible DNA
sequences which are associated with skin
cancer.
• At the end, you will need to decide which is more
important, your genes or your lifestyle?
Finding links between genes and
disease
• First, find a group of people with the disease (cases) and
a group without (controls).
• Each group is genotyped.
• A set of markers, i.e. S.N.Ps. (or ‘snips’), are scanned
into computers.
• Single Nucleotide Polymorphism = a single DNA
sequence variation in a base pair (i.e. a nucleotide A, G,
C or T) in the genome of a single species.
• e.g. AAGCCTA to AAGCTTA
• In this case the variation is between C and T
G.W.A.S.
• Epidemeologists look for variations that are readily
identified from a known panel of SNPs.
• Sometimes as many as 500,000 at one time, scattered
across the three billion base pairs in the human genome.
• When the study attempts to examine genetic variation
across the whole genome it is called a Genome Wide
Association Study, or GWAS.
Associations with disease
• If unique genetic variations are more frequent in people
with the disease, the variations are said to be
"associated" with the disease.
• The associated genetic variations are then considered
as pointers to the region of the human genome where
the disease-causing problem is likely to reside.
• So let’s look at melanoma – GWA studies have shown
three loci .
(a locus, plural loci, is the specific location of a particular
DNA sequence)
Melanoma Genes
Melanocortin 1 receptor
MC1R
• Polymorphisms or mutations in MC1R make it function
less well.
• These people make less black melanin and so have
white skin.
• Some variants cause red hair and freckles.
• Little variation seen in African populations: there is
strong evolutionary pressure against change in this
gene.
• Much variation in European populations:
there is much less evolutionary pressure
because of less UV radiation at higher latitudes.
MC1R
MC1R
9% in GWAS had the higher risk variant
TTACGTTTACCCAGAAATGGTACAATGTTTGTGATAACTACATCA
AATGCAAATGGGTCTTTACCATGTTACAAACACTATTGATGTAGT
91% have the lower risk variant
TTACGTTTACCCAGAAATGGTACAACGTTTGTGATAACTACATCA
AATGCAAATGGGTCTTTACCATGTTGCAAACACTATTGATGTAGT
Odds Ratio 1.67 for malignant melanoma
(Odds ratio is the odds of getting the disease for someone who has the harmful variant compared to the odds of
getting the disease for someone who doesn’t have the harmful variant.)
Tyrosinase – TYR
• An enzyme that converts tyrosine to melanin,
the skin pigment.
• Mutations in this gene cause variations in skin pigment.
• Mutations which disrupt the function of the enzyme
entirely cause albinism.
TYR
27% in GWAS had the higher risk variant
TCTTCCTCAGTCCCTTCTCTGCAACAAAATCTGTGTGGTCTTTTA
AGAAGGAGTCAGGGAAGAGACGTTGTTTTAGACACACCAGAAAAT
73% had the lower risk variant
TCTTCCTCAGTCCCTTCTCTGCAACGAAATCTGTGTGGTCTTTTA
AGAAGGAGTCAGGGAAGAGACGTTGCTTTAGACACACCAGAAAAT
Odds Ratio 1.29 for malignant melanoma
CDKN2A
•
•
•
•
•
Cyclin-dependent kinase inhibitor 2A.
Makes 3 different proteins.
Is an important tumour suppressor.
Expression increases with age.
Decreases number of own
stem cells.
CDKN2A
50% have this higher risk variant
TGGTAACCTTGAGTCCTGTGAATCTATGCCTGCAGAGGGATCAAT
ACCATTGGAACTCAGGACACTTAGATACGGACGTCTCCCTAGTTA
50% have this lower risk variant
TGGTAACCTTGAGTCCTGTGAATCTGTGCCTGCAGAGGGATCAAT
ACCATTGGAACTCAGGACACTTAGACACGGACGTCTCCCTAGTTA
Odds Ratio 0.85 for malignant melanoma
So, is GWAS reliable?
• You may have inherited a genetic variation
that is statistically linked to, or associated
with, a disease but this association may
not signify a causal link.
• The fact that hundreds of thousands of
base pairs have been “searched” in a
GWA study, as individual “hypothesis
tests”, is bound to lead to some “false
positive” clues.
Heart disease marker found!
• 1st December 2009 a new genetic marker was
announced – based on a GWA study.
• 156 known heart disease patients (cases) were
compared with 41 healthy adults (control).
• The marker is a slight, but precise variation in the
chemistry of one gene detected in the DNA of the
patients’ white blood cells.
• Patients were found to be more than three times as likely
as non-sufferers to have the variant in the genetic
material of their cells.
• Question: is this a normal variation in the gene? Or is the
abnormality related in someway to hardening of the
arteries?
as an epidemiologist…
• If you were told you had a marker based on this study of
156 known heart disease patients (the cases) and 41
healthy adults (the controls)… what should you be
asking?
• Is the sample size big enough to infer a link? – no, a
bigger sample size is required.
• Is the sample size balanced between controls and
cases? – no, it would be better to have them equal in
number.
• Should you think about the age and sex of the
sample? – yes, to avoid too many variables.
• If it is a robust association and a patient has the
variant gene will they definitely get heart disease? –
no, there is a difference between relative and absolute
risk. We can only say they have a higher relative risk.
• Should a patient eat a low fat diet to reduce the risk?
– YES!
• Fact – in Northern Ireland, our diet contains too much
saturated fat.
Heart disease and cholesterol
• Cholesterol is a significant heart disease risk factor. It is
diet related.
• But cholesterol is needed for cell membranes, vit. D
metabolism and steroid-based hormones.
• The ratio between high and low density lipoproteins
attached to the cholesterol is related to cardiovascular
risk.
• HDL has a useful effect in reducing cholesterol and
taking it back to the liver. HDL actually protects against
thickening of arteries. HDL levels can be raised by
exercise.
• LDL can contribute to diseases of the heart. Levels can
be lowered by eating a low fat diet and, if necessary,
taking medication.
Cholesterol levels
In the UK, the average total cholesterol level is 5.7mmol/l.
The levels of total cholesterol fall into the following
categories:
•ideal level: cholesterol level in the blood less than
5mmol/l.
•mildly high cholesterol level: between 5 to
6.4mmol/l.
•moderately high cholesterol level: between 6.5 to
7.8mmol/l.
•very high cholesterol level: above 7.8mmol/l.
•In rare cases, a young person can present with high
levels of low density lipoproteins. This is sometimes due
to rare mutations in some genes that have been
inherited from their parents.
Familial hypercholesterolemia (FH)
•
•
•
•
A rare condition.
Caused by a gene mutation on chromosome 19.
Passed through families as a dominant, autosomal gene.
Heterozygous patients (FH N) show some symptoms of
the disease.
• Homozygous patients (FH FH) show much more severe
symptoms.
Two families, two problems
• Family A are the Whites. Their son Brian is in his mid30s and has high cholesterol levels (8mmol/l) with high
levels of LDL.
• You decide to run a test to see if he has FH (familial
hypercholesterolemia).
• You also test his sister Anna and brother Colin.
• To do this you are going use gel electrophoresis.
• A sample of their DNA is taken and prepared using
Restriction Length Polymorphism analysis and PCR.
DNA is very long
•
•
•
•
2 metres per cell!
3 billion letters long (i.e. ACTG and so on).
Like a piece of string.
Specific enzymes can cut the DNA at specific nucleotide
sequences. e.g. GTTAAC is cut by one sort of enzyme
and TTAA cut by another.
Restriction Fragment Length
Polymorphism analysis & PCR
• RFLP is defined as a variation in the number of
restriction sites, or nucleotide sequences, in a specific
DNA region of one individual compared with another.
• RFLP analysis – a specific region of DNA (usually within
or near the gene of interest) is amplified using
Polymerase Chain Reaction (PCR).
• PCR makes millions of copies of DNA – enough to work
with and test.
• A PCR machine (thermalcycler) automates the process.
It effectively ‘photocopies’ DNA.
DNA Electrophoresis
• Uses a gel made of seaweed (agarose). It is porous thus
allowing DNA strands to ‘wiggle’ through.
• The DNA fragments have been pre-prepared.
• Enzymes have been added that cut the DNA at a
sequence associated with the FH mutation.
• DNA has an overall negative charge due to its
phosphate backbone.
• When a current is run through the gel the DNA
fragments will move from the negative toward the
positive electrode.
• Small DNA fragments are able to move further than
larger ones.
• Brian’s sample (E) will be loaded in Lane 5
• Anna’s (B) is loaded in lane 2 and Colin (D) lane 4
loading prepared
DNA into
agarose gel
DNA fragments move by size
big
medium
small
+ve
-ve
gels and staining
• Gels are run in an electrophoresis tank for
approximately 30 minutes at 150 volts.
• Check for bubbles at the electrodes.
• After, gels are placed in a DNA stain
solution for 5 mins.
• They are then de-stained in distilled water
for 20 mins. or more until the DNA banding
can be clearly seen in the gel.
while we’re waiting… another family
• Family B are the Smiths. The parents are 11&12.
• Their son Fred (25) is showing signs of a minor heart
disorder (*) but both parents are clear.
• You create the family pedigree below:
Patient 25
•The disease * is dominant.
•Who had it first?
•Does the condition only affects males?
Can you find where the gene is
located?
Down the left-hand side the number of sequence
repeats in locus K are shown.
Can you find the repeat sequence of DNA which is
shared by all those with the disease *?
Notice anything odd?
• Is 25 the child of 11 and 12? Why or why not?
• Notice anything else? Do you need a hint?
Blood Groups
(an example of co-dominance)
Phenotype
Genotype
A (dominant)
AA or AO
B (dominant)
BB or BO
AB (co-dominant)
AB
O (recessive)
OO
Blood group inheritance
Parents’
blood
phenotypes
O
A
O
O
O, A
A
O, A
O, A
B
O, B
AB
A, B
O, A, B,
AB
A, B, AB
B
AB
O, B
O, A, B, AB
A, B
A, B, AB
O, B
A, B, AB
A, B, AB
A, B, AB
A problem!
• Genetic profiles can reveal information that presents an
ethical dilemma.
• In this case, blood types reveal that 11 is also not the
father of 21. 21 and 25 share the same mother as their
siblings but assuming he is the same person for both,
who is their father?
• Here is some help….
– 25 has the disease. The disease is dominant so the father must
also have it.
– Also, 21 is blood type A so the father cannot be type O and must
be A or AB. So the father could be 7 or 9.
– The father of 25 (O) cannot be AB-type, so the father cannot be
9.
• So, what are you going to tell the parents/children? How
certain are you, just using this test?
Your personal genetic profile…
Results of our FH test
Electrophoresis Controls
1
2
3
1. DNA Standard Markers
2. Normal Control
3. Control Homozygous for
FH mutation
Results of our FH test
Electrophoresis results
1
2
3
4
5
(Anna)
(Colin) (Brian)
6
1 = DNA standard markers
3 & 6 = controls for FH patient
Results of our FH test
•
•
•
•
•
•
Lane 1
Lane 2
Lane 3
Lane 4
Lane 5
Lane 6
DNA control
Anna homozygous normal = N N
homozygous FH = FH FH
Colin – homozygous normal = N N
Brian heterozygous FH = FH N
homozygous FH = FH FH
What are the parents? (use the sheet)
Conclusion
• GWA studies are an indication of a genetic association
with disease but they are a ‘scattergun’ approach.
• Disease can be associated with one or more gene
mutations.
• It helps to know family history/pedigree/socioenvironmental circumstances.
• You can now pay to have your genetic profile analysed
to determine your risk of certain diseases. But how
reliable are these tests and who should have access to
the information they contain?
• So, once more, considering all we have
learned, can you always blame ‘it’ on
your genes?
Thank you