Download DNA - University of Dayton

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Artificial gene synthesis wikipedia, lookup

Transcript
DNA
The Secrets it tells us about
Evolution!
Remember:





Gene –
Chromosome –
1 molecule of DNA = 1 chromosome
What are the building blocks of DNA?
What are the building blocks of protein?
How do genes code for genetic traits?

Answer:
1 gene  code for  one protein!

Examples:



Eye color
Hair color
Normal Blood clotting vs. hemophilia
We know how the code works!

CCCGATATTACGCTTAGGTACCGTC

Every 3 bases code for one amino acid!
(See board)
DNA & Evolution

Chimpanzees and Humans share 98-99%
of their DNA!

CCCGTCAGGCTAATACGAGCGGT
CCCGTCGGGCTAATACGAGCGGT

DNA & Evolution



Who can read the human genetic code?
The genetic code is UNIVERSAL!
Practical Implication:
Genetic engineering:
Bacteria are programmed with HUMAN
insulin gene to produce………….?