Download Old exam 2 from 2002

Name:__________________
Exam 2
ABT / ASC / ENT 360 Genetics
Feb. 20, 2002
Discussion Questions:
1. A plant species A, which has eight chromosomes in its gametes, was crossed with a
related species B, which has ten. The hybrids were sterile, and microscopic
observation of their pollen mother cells showed no chromosome pairing (no
bivalents, only univalents). A section from one of the hybrids that grew
vigorously was propagated vegetatively, producing a plant with 36 chromosomes
in its somatic cells. This plant was fertile, and produced large, showy flowers.
Explain these observations. (5 points)
2. Write the complementary strand for the following DNA strand. Label both the ends
of each strand to indicate polarity and/or chemical ‘ends’. (6 points)
ACGGCGTTTACCATACTACG
3. What is the A+T / C + G ratio for the above sequence? (2 points)
4. Two genes in corn are on chromosome 7 are identified by the recessive alleles glossy
leaves (gl) and branched ears (ra for ramosa). When a plant heterozygous for each
locus was crossed with a homozygous recessive plant, the following progeny resulted:
Gl ra / gl ra
Gl Ra / gl ra
gl Ra / gl ra
gl ra / gl ra
Total
88
6
102
4
200
What is the frequency of recombination between these two loci? (3 points)
2
5. List the three distinct components of a nucleotide of DNA, with the middle part in the
middle of your list. (4 points) You can use words, or a sketch of the chemical
molecules.
6. In humans, which chromosome can be found most often to vary from the normal
disomic condition (i. e., monosomic, trisomic, tetrasomic)? (3 points)
7. Tomato plants are diploid with 2n=2x=24. How many chromosomes are there in
each cell of a tomato plant that is: (2 points each)
trisomic for chromosome 4?
an autotetraploid?
monosomic for chromosome 1?
Multiple Choice. Answer the following questions by writing the correct letter in the
blank to the left of the question. (3 points each)
____ 8. Harvey and Chase, the two scientists who first showed that DNA, not protein,
was responsible for inheritance, used radiolabeled sulfur and phosphorus that
tagged either protein or nucleic acid in separate experiments. They used a virus
of E. coli called a:
A. prion B. bacteriophage C. Streptococcus pneumoniae D. plasmid E. viroid.
____ 9.Which type of RNA is most abundant in most cells?
A. ribosomal RNA B. transfer RNA C. messenger RNA D. antisense RNA E.
small nuclear RNA.
____ 10. Meselson and Stahl showed which method cells use to replicate DNA. What is
the name for this method?
3
A. dispersive B. semiconservative C. conservative D. liberal E. anarchy.
____ 11. Which cell component is responsible for cytoplasmic male sterility, used to
produce hybrid corn varieties?
A. nuclear genes B. chloroplasts C. mitochondria D. plasmids E. viroids.
____ 12. What is the name for the phenomenon of a chromosome breaking into several
pieces and rejoining, but a piece is lost in the process?
A. monosomic B. nullosomic C. duplication D. deletion E. inversion.
____ 13. How many origins of replication are found in a mitochondrial chromosome?
A. many B. three C. two D. one E. none.
____ 14. What shape are chromosomes in chloroplasts and mitochonria?
A. linear threads B. circles C. X-shaped D. Y-shaped E. dots.
____ 15. What is the general name for an individual with an anomalous number of
chromosomes resulting from the loss or duplication of single chromosomes?
A. aneuploids B. euploids C. polyploids D. amphidiploids E. haploids.
____ 16. How many base pairs are found in the human genome?
A. 2 million B. 10 million C. 3 billion D. 100 billion E. 400 million.
____ 17. How many hydrogen bonds are there between cytosine and guanine bases in a
DNA molecule?
A. one B. two C. three D. four E. none.
____ 18. Who was awarded the Nobel Prize in 1962 for elucidating the three-dimensional
structure of DNA?
A. Avery, MacLeod, and McCarty B. Hershey and Chase C. Griffith D. Watson
and Crick E. Meselson and Stahl.
4
____ 19. How many base pairs are there in one turn in a normal (B-form) DNA
molecule?
A. 3.4 B. 10 C. 7 D. 50 E. 104.
____ 20. What chemical is often used to produce chromosome doubling in order to
restore fertility to wide hybrids in plants, or to produce autoploids?
A. purine B. colchicine C. pyrimidine D. caffeine E. ribose.
____ 21. When would one observe an inversion loop in a organism’s karyotype?
A. during interphase B. during all stages of mitosis C. during meiosis I.
Matching
Using the following list, match the correct term to its definition: (3 points each)
a. topoisomerase II
b. DNA polymerase III
c. primase
d. DNA lygase
e. helicase
f. gyrase
g. proofreading
h. Okazaki fragment
i. prion
j. paracentric inversion
k. pericentric inversion
l. Robertsonian translocation
m. polytene chromosome
n. transformation
o. 5’  3’exonuclease
p. 3’ 5’ exonuclease
____ 22. The name for the process by which bacteria can take up external DNA and
incorporate it into their genome.
____ 23. The enzyme that begins DNA replication by adding a small length of RNA to
the DNA template.
____ 24. The type of chromosome structural change involving two chromosomes
exchanging entire arms.
____ 25. The ability of DNA polymerase III to correct mispairings during DNA
replication.
____ 26. The enzyme involved in rejoining DNA sections when the RNA is replaced
with DNA.
____ 27. The name for the lengths of DNA made as complements to the lagging strand of
DNA, made in discontinuous fashion.
5
____ 28. The type of chromosome structural rearrangement involving breakage on both
sides of the centromere, with an inversion of the broken piece.
____ 29. The enzyme that catalyzes the unwinding of the parental DNA duplex.
____ 30. The ability of DNA polymerase to cut out the RNA primer, one base at a time,
and replace the RNA with DNA nucleotides.
____ 31. The name for the group of infectious proteinaceous particles responsible for
bovine spongiform encephalopathy (mad cow syndrome) and chronic wasting
syndrome in deer and elk.