Download Lesson Plan - beyond benign

Lesson 2 Genetic Testing
(See accompanying CD or website or Restriction Enzymes
PowerPoint)
Background: Students have learned that Gena Karbowski has a breast cancer
tumor and have decided to test Gena to see if there is a chance that she has a
genetic version of the disease.
Goal: To introduce students to methods of DNA extraction, sequencing and
testing in order to solve medical issues.
Objectives: Students will…
 Collect a human DNA sample
 Look at restriction enzymes and complete a paper electrophoresis lab
activity
 Look at bioinformatics and explore how it is used in medical situations
Materials:
 91% COLD Isopropyl alcohol – 1 bottle (rubbing alcohol)
 Salt ( Non-Iodized)
 Liquid soap
 1 ml Plastic pipettes – 2 per student
 10 - 20 ml test tubes – 1 per student
 DNA extraction student sheet – 1 per student
 DNA sequence strips
 Restriction Enzymes Activity student worksheet
 LCD projector (optional)
 Scissors – 1 per student
 Access to the Internet
Time required: 1 x 45-60 minute class period
National Standards Met: S1, S3, S6, S7
Prep:
For Cheek DNA extraction-Prepare a stock solution of salt water by adding 8
grams of sodium chloride to a beaker and dissolving with 92 ml of distilled
water.
Prepare a stock solution of soap solution by adding 25 ml of liquid soap
to 75 ml of distilled water.
Procedure:
Day 1
 Explain to students that you have gotten Gena’s physical exam results
from the Doctor’s office and there is a lot more information.
Pfizer and Beyond Benign
Page 1












Explain that you also received another e-mail from Gena – handout the
e-mail.
Hand out the physical results and discuss with the students.
Explain to students that today they are going to do some genetic testing
to determine if Gena’s breast cancer was caused by genetics.
Explain that first they will learn how a DNA sample is collected by
collecting their own DNA.
Hand out the DNA extraction student sheet
Review students sheet and answer any questions
Have students complete the activity.
Explain that this is one way that the lab would collect Gena’s DNA for
testing.
So now what happens next? Explain that the students will now be
looking at restriction enzymes and the role that they play in DNA.
Show the Restriction Enzymes PowerPoint Presentation(instead of using
the presentation you may have the students use the background
information hand out)
Check for student understanding
Hand out the Restriction Enzymes Student Worksheet, the DNA
sequence strips and the restriction enzymes examples sheet
Review activity and check for understanding
Ask students to complete the activity


Day 2
 Explain to the students that now that they have an understanding of
what restriction enzymes do, they are going to model how restriction
enzymes are used in the lab in a process called gel electrophoresis and
that gel electrophoresis can be used to identify specific genes that cause
disease.
 Review the background information about gel electrophoresis with
students.
 Hand out the worksheets for the gel electrophoresis activity.
 Have students complete the activity
 Explain to the students that they have to use one more decoding process
to get meaningful results from Gena’s DNA.
 Handout the Human genome Background information sheet
 Review the content and check for understanding
 Take your students to the computer lab or somewhere where they can
access the Internet.
 Hand out the bioinformatics student activity sheet. Explain that they are
going to utilize the same database that geneticists use to research DNA
 Have students follow the directions and complete the activity
Pfizer and Beyond Benign
Page 2
Fine Family Physicians Medical Center
Full Physical Exam
Patient Name: Gena Karbowski
D.O.B.: 4/17/1963
■
Today’s date: 6/20/2007
SS#:886-54-0000
Day Phone: 755-289-9999
CBC (Complete Blood Count) Results:
Test
Name
What the test shows
Gena Karbowski
WBC
White Blood Cell
May be increased with infections,
inflammation, some cancers.
Within normal range
RBC
Red Blood Cell
Decreased with anemia;
increased when too many made
and with fluid loss due to
diarrhea, dehydration, burns
Normal
%Eos
Eosinophil
Shows parasitic infection present, None
Inflammation
Platelet
Platelet
Decreased or increased with
conditions that affect platelet
production; blood clotting
normal/abnormal
■
Urinalysis results: Test
Clotting normal
results show no glucose excretion, indicating patient
does not have diabetes.
Pfizer and Beyond Benign
Page 3
■
IgE (Immunology) Test Results: Slightly
elevevated
Allergen
Explanation
Results for Gena Karbowski
Seasonal
Rhinitis or
Asthma
Allergen to plants
Negative
Oral Allergy
Syndrome
Food Allergies
Negative
Perennial
Rhinitis or
Asthma
Pet Allergens
Negative
Eczema
Dust mites, Animals, airborne allergens positive
Anaphylaxis
Caused by nuts and shellfish and
constricts airways
Negative
Drug Allergy
There are limited tests available for
drugs and antibiotics.
N/A No current medications
Bee and
Many individuals stung by these insects N/A No sting reported
Wasp Venom will develop severe reactions
Allergy
■
Chest X-Ray: Results
show no signs of tumors, pathogens, or fluid in lungs.
This indicates patient does not have lung cancer, emphysema, pneumonia,
and bacterial
infection in
lungs
Pfizer and Beyond Benign
Page 4
 Physical examination (no problems) (Left, Right, or Bilateral)
o Change to diagnostic or add ultrasound if indicated.
Indicate Area of Concern on Graphic
Right
Left
Notes: Box
above indicates the position of the lump examined during the physical exam. Gena is a 44 year old
woman with three children Elizabeth 22, Eric 16 and Ariel 14. She has been coming to see me for annual
screening exams for five years. She has never had abnormal results in her previous exams. Gena came to see me
with concerns about a lump on the upper right side of her right breast. She has also been having skin irritation,
with redness around the same area. During her physical exam I noticed that the lump appeared to have an
irregular shape (not round) and a pebbly surface, somewhat like a golf ball. It is very hard, like a slice of raw
carrot. Gena complains of no other symptoms. I performed a biopsy of the lump and found it to be cancerous. I
have referred Gena to an oncologist for radiation treatment and a surgeon for removal of the lump.
PHYSICIAN SIGNATURE:
Dr. Devi Singh
Pfizer and Beyond Benign
DATE: 06/20/2007
Page 5
Gena’s E-mail – Student/Teacher Sheet
INSERT YOUR NAME HERE (If you want to)
From:
Karbowski, Gena ([email protected])
Sent:
Friday June 22nd, 2008 10.15 am
To:
Insert your name here (if you want to)
Subject:
Update on my life
Hello insert your name here (if you want to),
Well it seems that I do indeed have breast cancer but don’t worry; I’m going to be fine. I will
be having surgery tomorrow to remove the lump and then I will be having radiation just to
make sure all the cancerous cells are dead. Don’t worry about me though, the doctor said they
caught it early and I should make a full recovery.
I wondered for a while if I got this because of all those chemicals I worked with in the lab in
college but now I’m wondering if this is genetic. Can you run some tests for me?
Take care,
Gena
Pfizer and Beyond Benign
Page 6
Genetic Testing, cheek DNA extraction – Student Sheet
DNA extraction is the first step in DNA analysis. In order for Gena’s doctors to
determine if her breast cancer is due to a faulty gene (or genes) they must first
obtain a sample of Gena’s DNA. The epithelial cells lining the insides of the
mouth are a great source of DNA since they are very easy to obtain. In this
activity you will use several household chemicals to extract your own cheek cell
DNA. In order to extract DNA from a human cell the cellular and nuclear
membranes of a cell must be ruptured, allowing DNA to escape into the
surrounding environment.
IMPORTANT NOTE: MAKE SURE YOU HAVE NOT EATEN ANYTHING PRIOR TO
THIS LAB AND IF YOU HAVE, BE SURE TO RINSE YOUR MOUTH OUT WITH
PLENTY OF WATER. FOOD PARTICLES WILL INHIBIT A GOOD EXTRACTION.
Follow the procedure below to extract DNA from your own body.
Collect the following materials from the supply area:







1
1
8
1
2
1
4
ml of non iodized sodium chloride solution
ml liquid soap solution
ml of bottled or distilled water
plastic test tube with cap
plastic pipettes
paper cup
ml COLD 91% isopropyl alcohol
1. Use a plastic test tube and place 8 ml of water (bottled or fountain) into
the tube and cap with screw top.
2. Gently chew the insides of your cheeks for 30 seconds. This step is
necessary to harvest enough cheek cells for a good DNA extraction.
3. Place water from plastic tube into your mouth and swish for 30-45
seconds. DO NOT SWALLOW THE WATER!
4. Spit water into a small cup and pour the contents back into your plastic
test tube.
5. Add 1 ml of the sodium chloride solution to your plastic tube and cap
with cover. Gently mix by inverting the test tube several times.
6. Add 1 ml of liquid soap to your plastic tube and cap. Gently mix contents
by slowly turning the test tube upside down and right side up 5 times.
Try not to create bubbles!!
7. Add 3-4 ml of the ice-cold 91 % isopropyl alcohol to the test tube at a
45°angle down the side of the test tube.
8. Let tube sit for 5 minutes and observe as DNA floats to the surface. It will
look like tiny bubbles.
Pfizer and Beyond Benign
Page 7
9. There you have it, your own genetic code. Since DNA is insoluble in
alcohol this DNA can be stored for a long time in a small screw top or
snap top vial.
10. If you wish to keep your DNA you may use a plastic disposable pipette to
remove some of your DNA from your plastic test tube and transfer it to a
small plastic microtube and top off with some alcohol.
Post Lab Questions:
1. When you look at your DNA sample are you looking at a single DNA
molecule or many? Explain.
2. What traits would you expect to find encoded in your DNA?
3. What trait is the most prevalent in your class?
Pfizer and Beyond Benign
Page 8
Restriction Enzymes Background Information
In the previous activity you extracted DNA from your cheek cells. DNA
extraction is the first step towards DNA analysis. In order for Gena’s DNA to be
analyzed for the presence of cancer genes her extracted DNA must be prepared,
or “chopped up”, into pieces with proteins called restriction enzymes. These
pieces of DNA are then tested and the results are interpreted. It may seem very
complicated but, as you will learn, it’s fairly simple. So, what are restriction
enzymes?
Restriction enzymes, sometimes called “molecular scissors”, cut a DNA
molecule at specific sites to create smaller fragments of DNA. Restriction
enzymes scan the DNA code until they find a very specific sequence of
nucleotides, called a restriction site, and make a specific cut in that point.
Restriction enzymes typically identify DNA sequences that are
palindromes. Palindromes are words that read the same forward as backwards.
For example, the words “mom” and “dad” are palindromes. The phrase “never
odd or even” also reads the same forwards as backwards and is considered a
palindrome. Genetic palindromes are similar to verbal palindromes. A
palindromic sequence in DNA is one in which the 5’ to 3’ base pair sequence is
identical on both strands (the 5’ and 3’ ends refers to the chemical structure of
the DNA). Each of the double strands of the DNA molecule is complimentary to
the other; thus adenine pairs with thymine, and guanine with cytosine.
Restriction enzymes (also known as restriction endonucleases) recognize
and make a cut within specific palindromic sequences, known as restriction
(or recognition) sites, in the genetic code. In general, a recognition site is a 46 base pair sequence found in the genetic code. HaeIII is an example of a
restriction enzyme that searches the DNA molecule until it finds this specific
sequence of four nitrogen bases:
5’ GGCC 3’
3’ CCGG 5’
Once HaeIII finds, or recognizes, the GGCC sequence, it cleaves (cuts)
the DNA between the GG and CC bases. Look at the DNA sequence below. Can
you spot the HaeIII recognition site? Once the recognition site was found HaeIII
would go to work cleaving the DNA.
5’ TGACGGGTTCGAGGCCAG 3’
3’ ACTGCCCAAGGTCCGGTC 5’
Pfizer and Beyond Benign
Page 9
HaeIII would cut the DNA into two pieces or fragments, right in the
middle of the GGCC recognition site:
5’ TGACGGGTTCGAGG
3’ ACTGCCCAAGGTCC
CCAG 3’
GGTC 5’
These straight cuts produce what scientists call blunt ends.
NAMES
Restriction enzymes come from bacteria and the name of a particular
restriction enzyme is related to the type of bacteria in which the enzyme is
found, as well as the order in which the restriction enzyme was identified and
isolated. For example, EcoRI gets its name from the R strain of E. Coli bacteria.
Since EcoRI was the first restriction enzyme discovered in E. Coli, “I” is used in
its name.
Remember how HaeIII produced a blunt end? Well, other restriction enzymes
can make uneven, staggered cuts. (Think of a zigzag pattern.) EcoRI, for
instance, searches for the DNA for following palindromic sequence:
5’ GAATTC 3’
3’ CTTAAC 5’
Once the restriction enzyme recognizes this site it will cut between the G
and A on both the top and bottom strands of the DNA molecule. Do you notice
what happens when DNA is cut in that location? Instead of making a blunt cut,
EcoRI results in fragments that are uneven or staggered. The example below
shows that action of EcoRI:
5’ GAATTC 3’
3’ CTTAAG 5’
EcoRI cuts between the G and A on the top and bottom strands:
5’ G
3’ CTTAA
AATTC 3’
G 5’
Because the enzyme produces a jagged cut, the ends of the DNA
fragments are called “sticky ends”. Sticky ends are useful in the field of
recombinant DNA technology since different DNA fragments with
complimentary sticky ends can be combined in different ways to create new
molecules. You will encounter recombinant DNA technology when you insert a
foreign gene into a bacterial plasmid.
The restriction sites of several different restriction enzymes, with their
cut sites, are shown below:
Pfizer and Beyond Benign
Page 10
Pfizer and Beyond Benign
Page 11
Restriction Enzymes Activity – Student Worksheet
Cut the DNA sequence strips along their borders. These strips represent
a double stranded DNA molecule. Each sequence of letters represents
the DNA backbone, while the vertical lines between each base pair represent the
hydrogen bonds between nitrogen bases.
1. You will model the activity of EcoRI. Scan the DNA sequences of strip
1 until you find the EcoRI restriction site (refer to the list above for
the sequence). Make cuts through the DNA backbone by cutting
between the G and the first A of the restriction site through both
strands. Be sure not to cut all the way through the strip!
Remember that EcoRI cleaves the backbone of each DNA strand
separately and also separates the hydrogen bonds between the base
pairs.
2. Now separate the hydrogen bonds between the cut sites by cutting
through the vertical lines that connect the nitrogen bases. Separate
the two pieces of complimentary DNA. Look at the new DNA ends
produced by EcoRI. Are they blunt or sticky? Write “EcoRI” on these
cut ends. Place them on your desk in front of you.
3. Repeat the procedure with strip 2, this time simulating the activity of
SmaI. Find the SmaI site, and cut the DNA backbones at the
restriction cut sites. Are there any bonds that are cut between the cut
sites? Are the resulting ends blunt or sticky? Label the new ends
SmaI, and place them on your desk in front of you.
4. Simulate the activity of HindIII with strip 3. Are these ends sticky or
blunt? Label the new ends HindIII, and place them on your desk in
front of you.
5. Repeat the produce one more time with strip 4, simulating EcoRI once
again.
6. Pick up the “front-end” DNA fragment from strip 4 (an EcoRI
fragment) and the “back-end” HindIII fragment from strip 3. Both
fragments have single stranded ends that are 4 bases long. Write
down the base sequences of the two ends, and label them EcoRI and
HindIII. Label the 5’ and 3’ ends. Are the base sequences of the
HindIII and EcoRI tails complimentary?
7. Put the HindIII fragments down. Now, pick up the back-end DNA
fragment from strip 1 (cut with EcoRI) and Compare the single
stranded tails of the EcoRI fragment from strip 1 to the EcoRI
Pfizer and Beyond Benign
Page 12
fragment from strip 4. Write down the base sequences of the single
stranded tails, and label the 3’ and 5’ ends. Are they complimentary?
8. Imagine that EcoRI has cut a completely unknown DNA fragment. Do
you think the single stranded tails of these fragments would be
complimentary to the single stranded tails of the fragments from strip
1 and strip 4? Justify your answer.
9. An enzyme called DNA ligase re-forms the bonds between
nucleotides. In order for DNA ligase to work, two nucleotides must
come close enough together in the proper orientation for a bond to
form. Do you think it would be easier for DNA ligase to reconnect two
DNA fragments produced by the action of EcoRI or one fragment
cleaved by EcoRI with one cleaved by HindIII? What is your reason?
Pfizer and Beyond Benign
Page 13
DNA Sequence Strips – Student Sheet
COPY SINGLE SIDED!
Pfizer and Beyond Benign
Page 14
Restriction Enzyme Examples – Student Sheet
Pfizer and Beyond Benign
Page 15
Gel Electrophoresis Background Information
You have already learned about restriction enzymes and how they
cut DNA. When you perform an actual restriction digest, you place the DNA and
restriction enzyme into a small tube and let the enzyme begin cleaving the DNA.
Before the reaction starts, the mixture in the tube looks like a clear fluid. Guess
what? After the reaction is complete, it still looks like clear fluid! Just by
looking at it, you can’t tell that anything special has happened.
In order for the restriction digestion to mean much to you, you have to be
able to see the different DNA fragments that are produced.
Gel electrophoresis takes advantage of the chemical nature of DNA to
separate the fragments. The phosphate groups in the backbone of DNA are
negatively charged. In electrical terms DNA molecules will be attracted to
anything that is positive charged. In gel electrophoresis, DNA molecules are
placed in an electric field (which has a positive and negative pole) so that they
will migrate (or move) toward the positive pole.
The electric field in
electrophoresis makes the different
DNA fragments move and causes
them to separate. This whole process
is carried out in a gel made of
agarose. If you have ever made or
eaten Jell-O or Jelly, you have had
experience with a gel. One gel
material that is often used for
electrophoresis of DNA is agarose,
derived from seaweed. To make a gel
for DNA electrophoresis (called
pouring or casting a gel), you dissolve
some agarose powder in some boiling
buffer solution, pour in into a dish, and let it cool. As the gel cools it hardens.
Since the plan for agarose gels is to add DNA to them, scientists place a comb
in the liquid agarose after it has been poured into the desired dish and let the
agarose harden around the comb. When the comb is removed from the
hardened agarose gel, a row of holes in the gel remains. The holes made by the
comb are called sample wells. DNA is placed into the wells with a micropipette
before electrophoresis is begun.
Pfizer and Beyond Benign
Page 16
For agarose gel electrophoresis, the gel is placed in a
tank or chamber of salt water solution (not table salt)
called buffer that balances the pH. An electric current is
then applied across the tank so that it travels through
the buffer and agarose gel. When the electric current is
applied, the DNA molecules begin to migrate (move)
through the gel from the negative toward the positive
pole of the electric field. Why? Because DNA is negative
and is attracted to the positive.
The electricity is applied for between 20-30 minutes, during which time
the gel does its most important work. All of the
DNA fragments in the gel migrate toward the
positive pole, but the agarose makes it more
difficult for larger DNA fragments to move than
smaller ones. So in the same amount of time,
smaller DNA fragments migrate much farther than
a large ones. You can think of agarose gel
electrophoresis as a DNA footrace, where the “runners” (the DNA fragments
being separated) separate like the runners in a real race. The smaller the
molecule, the faster it will run.
In electrophoresis races, the small
DNA always wins!
After 20-30 minutes, the electric current is turned off, and the entire gel is
placed into a cationic (positively charged) DNA staining solution. After staining
the DNA can be visualized. The DNA fragments now look like a series of stripes
(bands) in the gel; each separate band composed of one size DNA fragment.
There are millions of actual molecules in each band, but they are all
approximately the same size.
Pfizer and Beyond Benign
Page 17
Paper Electrophoresis - Student Activity
You will be provided with three linear models of Gena’s DNA (base pairs are not
shown) and an outline of a gel electrophoresis gel. The models show where Gena’s
DNA would be cut with three different restriction endonucleases. You will model
the digestion of three of Gena’s DNA molecules with three different restriction enzymes
and then simulate agarose gel electrophoresis of the restriction fragments.
Materials Needed:
Scissors
Tape or glue stick
1. Cut out the three pictures of Gena’s 15,000 Base Pair DNA Fragment Sequence
Molecules
2. Model the activity of EcoRI on Gena’s DNA by cutting the strip at the vertical
lines representing the EcoRI sites. You have now “digested” Gena’s DNA
molecule. Put your “restriction fragments” in a pile away from the other two DNA
strips.
3. “Digest” Gena’s second DNA model with BamHI. Put the BamHI fragments in a
separate pile.
4. “Digest” Gena’s third DNA molecule with the restriction enzyme HindIII. Put
these fragments in a third pile.
5. You will separate the EcoRI, BamHI, and HindIII fragments in a model gel as if
you had really loaded them into sample wells. Arrange Gena’s fragments in the
way that they would be separated by agarose gel electrophoresis. Designate a
place on your desk as the end of the gel with the sample wells. Starting with the
EcoRI fragments, place them from longest to shortest, with the longest one
closest to the well.
6. Next, separate the BamHI fragments from each other and place them adjacent to
the EcoRI fragments on your desk. Be sure to order each fragment correctly by
size with respect to the other BamHI fragments and to the EcoRi fragments that
you have already laid out on your desk.
7. Repeat the same procedure for the HindIII restriction fragments. You should now
have all three of fragments lengths arranged in order on your desk in front of
you.
8. Check with your teacher at this point for accuracy before going further.
9. Look at the outline of the gel electrophoresis gel provided by your teacher. Do
you notice that it has a size scale in base pairs on the left-hand side and that
sample wells are drawn? Using the outline and the size scale as a guide, draw
the pattern that your restriction digest for Gena’s DNA would make on an actual
gel. Use the EcoRI sample well for the EcoRI fragments and so on.
10. After drawing the bands representing Gena’s restriction fragments, use the size
information on the paper strips to label each band on your gel with the sizes, in
base pairs, of each fragment.
Post Activity Questions:
1. Are all the smaller fragments across the gel “lanes” in front of all the larger
fragments?
2. Does the size scale have regular intervals?
Pfizer and Beyond Benign
Page 18
3. What is the size (in base pairs) of Gena’s largest fragment?
4. Analysis of DNA electrophoresis has revealed that DNA fragments smaller than
300 base pairs may indicate the presence of genes that have been associated
with cancer. BRCA 1, p53, and CHEK2 are three genes that have been identified
in cancer research. Does it appear from your electrophoresis model that Gena
may have a cancer gene? Explain your answer.
5. Would you recommend that Gena’s 160 base pair fragment be sent to the
laboratory for DNA sequencing analysis?
Below are three representatives of a 15,000 base pair DNA molecule. Each
representation shows the locations of different types of restriction sites, with vertical
lines representing the cut site. The numbers between, show the sizes (in base pairs) of
the fragments that would be generated by digesting the DNA with that enzyme.
EcoRI sites
4,000
3,500
2,500
5,000
BamHI Sites
6,000
4,000
3,000
1,840
160
HindIII
8,000
Pfizer and Beyond Benign
4,500
2,500
Page 19
Gena’s Gel Electrophoresis
EcoRI
Size scale in
base pairs
HindIII
BamHI
Sample
wells
8,000 --
6,000 --
4,000 --
3,000 --
2,000 --
1,000 -500 -400 -300
300 ---200
200 --100 -50 -25 --
Pfizer and Beyond Benign
Page 20
Bioinformatics and the Human Genome Project
Background Information:
Since the elucidation of the structure of DNA by James Watson and
Francis Crick in the mid 20th century the world has seen an explosion in genetic
knowledge. With the development of computer processing and technology the
ability to study DNA was taken to new heights. The Human Genome Project,
begun in 1986, with the cooperation of public and private companies set about
the monumental task of sequencing all 3 billion base pairs in the human
genome.
It was no small task and many problems were encountered. With the
help of high speed computers and state of the art DNA technology the Human
Genome Project was completed in 1996. With the Human Genome sequence
now complete, scientists were faced with the additional task of making sense of
the enormous amounts of genetic information now available to them. The
explosion of data produced by the Human Genome Project led to the creation of
a new scientific disciple: Bioinformatics. Bioinformatics focuses on the
acquisition, storage, analysis, modeling and distribution of the many types of
information embedded in DNA.
A variety of bioinformatics software has been developed. Gene prediction
software, for example, attempts to identify genes within a long DNA sequence
while sequence alignment software uses computers to determine if a sequence
of DNA is similar to that of a known gene. One of the most popular and widely
used sequence alignment programs is called BLAST, Basic Local Alignment
Search Tool. This program searches a nucleic acid (or protein) sequence
database for matching or similar sequences. The BLAST search engine allows
scientists to determine if a DNA or protein sequence is part of a known gene. If
the BLAST search shows that a particular DNA sequence is part of a known
gene it allows the scientists to continue with their efforts to determine the
function of that gene. It also provides a way for scientists to confirm the identity
of unknown DNA sequences, thereby saving much time, energy, and money in
the process.
Pfizer and Beyond Benign
Page 21
Bioinformatics Student Activity: Mining the Genome
In this activity you will use a government funded bioinformatics website,
the National Center for Biotechnology Information (NCBI), to conduct a
sequence alignment search to determine if Gena’s smallest fragment, 160
base pairs, visualized by gel electrophoresis, matches any known DNA
sequences in the database.
Instructions:
1. Log onto the following website: http://www.ncbi.nlm.nih.gov
2. Click on BLAST
3. Under BLAST Assembled Genomes, choose the word “human”.
4. In the large box enter the first 30 bases pairs of Gena’s DNA sequence
obtained from the electrophoresis activity.
5. Scroll down and click “Begin Search”
6. You will advance to a screen that gives you information of Query,
Database, Job Title, etc. At this point you should click “View Report”
adjacent to Request ID.
7. A new screen will appear showing the results of your search. The
important information on this screen is found under the “Descriptions”
heading. Here you should read the following words: “Sequences
producing significant alignments”. You should see information
concerning the species and chromosome number that Gena’s DNA
sequence search matched. (You don’t have to worry about the Score and
E Value.)
8. Scroll down to the word “Alignments” just below descriptions.
9. Under the words “Features flanking this part of subject sequence:” you
should find an important piece of information for determining if Gena’s
160 base pair sequence matches any known DNA sequences. Do you see
what that important clue is? If so, write it down
here:_____________________________
10. Congratulations you have just completed your first DNA sequence
alignment search in the emerging scientific field of Bioinformatics.
Post Activity Question:
1. What do you conclude about Gena’s DNA sequence from this activity?
Pfizer and Beyond Benign
Page 22
Gena’s 160 Base Pair DNA Fragment
Sequence Molecules:
TTCCCATCAAGCCCTAGGGCTCCTC
GTGGCTGCTGGGAGTTGTAGTCTG
AACGCTTCTATCTTGGCGAGAAGCG
CCTACGCTCCCCCTACCGAGTCCC
GCGGTAATTCTTAAAGCACCTGCAC
CGCCCCCCCGCCGCCTGCAGAGGG
CGCAGCAGGTCTT
Pfizer and Beyond Benign
Page 23
Gena’s Genetic Testing Results
Department of Genetics
Yale University School of Medicine
333 Cedar Street
New Haven, CT 06520
License # State of CT.CL-00084
Report Re: Karbowski, Gena
Reason For Study: Carrier Analysis for BRCA1 and 2 mutations
General genetic screen
Med. Rec. #:
Lab #: 00000-0
Source: BLOOD
Referring Provider 1
Referring Provider 2
Dr. Devi Singh
Fine Family Physicians
Mystic, CT 02020
Fax: (203) 764-8401
Family #: 00000
Birth Date: 4/17/1963
Referring Provider 3
Interpretation: Two OF THE MOST COMMON Breast Cancer MUTATIONS, BRCA1--185delAG, and
P53 WERE screened IN THIS PATIENT.
Gene
Mutation Screened
BRCA1
P53
Interpretation
185delAG
Protein
No Mutation Detected
Mutation Detected
Females with mutations in P53 are high risk for aggressive breast cancer and ovarian
cancer. Males with this mutation are at increased risk for prostate cancer and possibly breast
cancer.
Interpretation: THE CARRIER GENE CNGA3 for ACHROMATOPSIA WAS FOUND IN THIS PATIENT.
Interpretation: THE CARRIER GENE FOR MALE PATTERN BALDNESS WAS FOUND ON THE X
CHROMOSOME OF THIS PATIENT.
Signed:
Date:
Allen E. Bale, M.D.
Director, DNA Diagnostics Laboratory
Signed:
Date:
Michael R. Rossi, Ph.D.
Molecular Diagnostics Fellow
NOTE: While results obtained from this type of testing are usually highly accurate, infrequent laboratory errors may
occur.
NOTE: PCR-based tests are performed pursuant to a license agreement with Roche Molecular Systems, Inc. The
results of this
testing and its implications should be interpreted and conveyed by a professional trained in genetics.
Pfizer and Beyond Benign
Page 24
Condition
Pattern of
prevalence
Gene (s) in
which
mutations
cause the
condition
Chromosome
on which the
gene is found
– if known
Treatment
Alzheimer’s Disease
Achromatopsia
1 : 2,500
1 : 40,000
#1, #14, #19, #21
#2, #14
None
None
Asthma
5% of the population
PS1, PS2, APP
CNGA3, CGNB3 and
GNAT2
Unknown
Inhaler, medication
Breast Cancer
Breast Cancer
5% of the 182,000
breast cancer cases
reported each year
BRCA - 2
BRCA - 1
#5, #6, #11, #14, and
#12
#13
#17
Cystic Fibrosis
1 : 2,500
CFTR
#7
Fragile X Mental
Retardation
Haemophilia A
Huntington Disease
Male pattern baldness
1 : 4,000 boys
1: 2,000 girls
1 : 10,000 boys
1 : 20,000
No data
FMR1
X
Factor 8 c
IT15
AR
X
#4
X
Where is the BRCA1 gene located? Cytogenetic Location: 17q21
Molecular Location on chromosome 17: base pairs 38,449,839 to 38,530,993
Pfizer and Beyond Benign
Page 25
Lumpectomy,
radiation,
chemotherapy,
mastectomy etc.
based upon severity
Physiotherapy,
antibiotics, enzymes
to digest food and diet
Educational and
behavioral support
Factor 8
Supportive therapy
None
Disorder student information sheet
BRCA-1
Recently, scientists have begun to isolate genes responsible for hereditary breast
cancer. In 1994 the gene, named Breast Cancer 1 (BRCA-1), was finally isolated in
Chromosome #17, one of the 23 pairs of chromosomes found in most human cells. An
altered BRCA-1 has been linked to the development of breast and ovarian cancer.
In 1995, scientists developed experimental tests for detecting several recently
discovered cancer genes, including BRCA-1. However preliminary studies have shown
that testing positive for an altered BRCA-1 gene does not necessarily mean a woman
will develop breast cancer. At least 15% of the women who carry the altered gene will
never develop the disease. Scientists have no way of knowing yet which women fall
into that category. In addition, because BRCA-1 alterations occur in many different
places scattered throughout the gene, developing an accurate test will be very difficult
to do.
The altered BRCA-1 gene appears in only 5% of the 182,000 breast cancer cases that
develop. If a woman tests negative (that is, she does not have the altered gene), this
does not necessarily mean she will be free of breast cancer during her lifetime.
BRCA-2
Scientists also have recently located the gene BRCA-2 on Chromosome #13. Like
BRCA-1, BRCA-2 appears to be a cancer-causing gene when altered. BRCA-2
appears to account for as many cases of breast cancer as does BRCA-1. BRCA-2
apparently triggers breast cancer in males as well as in females.
P53
There are specific genes in the cells of our bodies that normally help to prevent tumors
from forming. One of these tumor-suppressor genes, called P53 ("p" for protein and "53"
for its weight) was recently named "Molecule of the Year" by the editors of the journal
Science. This protein plays a major role in cell growth. The job of P53 is to prevent
(suppress) cells from growing. When it has been damaged or altered, P53 loses its
ability to block cell growth. Changes to the gene result in an increased risk of cancer.
Almost 50% of all human cancer cells contain a P53 mutation. These cancers are more
aggressive and more often fatal. Since P53 is so important for normal cell growth in
humans, researchers are continuing to look for ways to diagnose, prevent, and treat
cancer associated with P53.
Pfizer and Beyond Benign
Page 26
ATM
After more than a decade of intensive searching, researchers have isolated a recessive
gene that increases the risk for people to develop some kinds of cancer (as well as a
rare genetic disease). The gene, ataxia telangiectasia mutated (ATM) may be involved in
many cancers, including breast cancer. The normal role of the ATM gene is to control
cell division. Although researchers do not know why an altered ATM causes cancer,
1% of Americans (more than 2 million people) carry at least one copy of the defective
form of the gene. By examining the role of altered ATM genes, scientists are hoping to
shed some light on what makes cells live, grow, and die.
Besides being associated with cancers, the ATM gene may also identify those
individuals who are sensitive to radiation. The altered form of the ATM gene is closely
linked to a childhood disorder of the nervous system called Ataxia Telangiectasia, or
AT. AT afflicts 1 in 40,000 children in the U.S. and 1 in 200,000 worldwide each year.
P65
With the recent discovery of the gene called P65, scientists are hoping to develop a
blood test to detect cancers of the breast and prostate at a much earlier stage than is
now possible. The altered form of P65 is linked to the overproduction of certain
hormones that may help to cause both breast and prostate cancers. The new blood
test, called the tumor blood marker, hopefully will allow doctors to monitor a patient's
response to cancer treatment. The level of the P65 protein marker in the blood
decreases as tumors are destroyed during therapy. A study is being performed to
determine if the tumor marker blood test is suitable for widespread use
Achromatopsia, the complete inability to distinguish color, is an autosomal recessive
disease of the retina. This means that both parents have one copy of the altered gene
but do not have the disease. Each of their children has a 25% chance of not having
the gene, a 50% chance of having one altered gene (and, like the parents, being
unaffected), and a 25% risk of having both the altered gene and the condition. In
1997, the achromatopsia gene was located on chromosome 2. A total inability to
distinguish colors (achromatopsia) is exceedingly rare. These affected individuals view
the world in shades of gray. They frequently have poor visual acuity and are extremely
sensitive to light (photophobia), which causes them to squint in ordinary light.
What causes Achromatopsia?
Achromatopsia is caused by an abnormality of the retina, that portion of the eye
responsible for “making the picture”. It is analogous to the film in a camera. In the
retina, there are three types of cells (cones) that are responsible for normal color
vision. These are the red cones, the green cones, and the blue cones. A balanced
distribution of these cells is necessary for normal color vision. If a child is born with
non-functioning cones, they will have achromatopsia. Sometimes children have a
reduced complement of the cones, in which case they will have partial or incomplete
achromatopsia. Achromatopsia is an inherited condition and so far three genes
(genetic markers found on chromosomes) are known to be associated with this
Pfizer and Beyond Benign
Page 27
condition: CNGA3, CGNB3 and GNAT2. The three chromosomes that may have
changes associated with achromatopsia are chromosome 14, chromosome 8q21- q22
and chromosome 2q11.
Male Pattern Baldness – The most common form of baldness is a progressive hair
thinning condition called androgenic alopecia or 'male pattern baldness' that occurs in
adult male humans and other species. The severity and nature of baldness can vary
greatly; it ranges from male and female pattern alopecia (androgenetic alopecia, also
called androgenic alopecia or alopecia androgenetica), alopecia areata, which involves
the loss of some of the hair from the head, and alopecia totalis, which involves the loss
of all head hair, to the most extreme form, alopecia universalis, which involves the loss
of all hair from the head and the body. too many androgen receptors make you bald.
The genetic reason for Pattern Baldness is linked to your mother's X-Chromosome.
Everyone gets one-half of their genetic make-up from their mother and their father.
The final chromosome pair of the 23 pairs is the sex determining set. While males are
XY and females are XX the determination of an individual’s sex is made by the father.
It is the father who gives either the X chromosome, which matches with the woman’s X
resulting in XX and a female child or the Y chromosome which joins with the woman’s
X resulting in an XY match and a male child. It is the X chromosome or female sex
chromosome that contains the gene for Male Pattern Baldness.
Pfizer and Beyond Benign
Page 28