Download SEG exam 2 1

Science and Ethics of Genetics
Name : __________________________________________________ ID # on back of last page
Honor Code: ____________________________________________
1. If a woman who obtained the services of a sperm bank, had a child that had Down’s syndrome, and it
was discovered that the extra chromosome came from the sperm, should the sperm bank be held
accountable? Should the donor be held accountable? Why or why not? (5 pts)
2. If children obtain half their genes from one parent and half their genes from the other parent, why
aren’t siblings identical? (5 pts)
3. Given the normal chromosome arrangement ABCDEFGHIJKLMN name the chromosome
rearrangements listed below. (9 pts)
ABCDEFHIJKLMN
__________________
ABCDEFGHIHIHIJKLMN
___________________
ABCDEFGHIJXYZKLMN
___________________
4. Multiple Choice (2 pts each)
____Test tube systems used to study DNA replication must include all of the following except:
a. a DNA molecule to be replicated.
b. deoxynucleotide triphosphates.
c. isolated cellular nuclei.
d. DNA polymerase and primers.
____Which of the following forms of DNA can serve as a template for DNA polymerase?
a. partially double-stranded RNA with a primer
b. circular double-stranded DNA
c. intact linear double-stranded DNA
d. single-stranded DNA with a primer
____When DNA replicates:
a. each daughter duplex will have one of the original parental
strands and one new strand.
b. one daughter duplex will be entirely new and the other will
have both original parental strands.
c. both daughter duplexes will be entirely new and the parental
duplex will be degraded.
d. each strand of each daughter duplex will have parts of the
parental strands and parts of new strands.
____Which of the following statements is true?
a. A cell can potentially make fewer different proteins than the
number of different genes it contains.
b. A cell can potentially make only the same number of different
proteins as the number of different genes it contains.
c. A cell can potentially make more different proteins than the
number of different genes it contains.
d. none of the above.
____To stimulate transcription, transcription factors:
a. must bind to the 5’ end of the gene to be transcribed.
b. must be in the cytoplasm of the cell
c. can bind anywhere on the gene to be transcribed
d. will bind to the TATA sequence at the 3’ end of the gene to be transcribed.
____To stimulate translation, the ribosome:
a. must bind to the 5’ end of the RNA to be translated.
b. must be in the cytoplasm of the cell
c. must bind to the 3’ end of the RNA to be translated
d. will bind to the TATA sequence at the 3’ end of the RNA to be translated.
e. a and b
____Assume that a wild-type sequence is 5'AGCCTAC3'. Indicate the sequence that
might be produced by the conversion of a puring to a pyrimidine
a. 5'AGTCTAC3'
b. 5'AGCCGCCGCCGCCTAC3'
c. 5'AGCCCAC3'
d. 5'ATCCTAC3'
e. 5'AGCCTGC3'
_____ The proteins that make up part of the structure of a chromosome are called
a) enzymes
b) histones
c) structural
d) nucleosomes
_____ Which of these is not part of a nucleotide
a) ribose
b) carbon
c) nitrogen
d) phosphate
e) none of these
_____ Which of these nucleotide bases is not found in DNA
a) adenine
b) uradine
c) guanine
d) cytosine
______The disorder Fragile X syndrome, a major cause of mental retardation, is caused by
a. production of enzymes that break the phosphate backbone.
b. UV light.
c. X-rays.
d. presence of an extra X chromosome in the sperm or egg.
e. duplication of multiple three-nucleotide repeats.
5. Several human females have been reported who are 46,XY in chromosome makeup but are missing
part of the short arm (p arm) of the Y chromosome. These females have poorly developed (streak) gonads
and are sterile. Individuals who are 46,XY and missing part of the long arm (q arm) of the Y are also
known but these individuals appear to be normal males. What does this suggest about the location of the
gene that determines maleness? (6pts)
6. In the movie “And The Band Played On” describe one of the ethical arguments that took place during
the HIV controversy. (6 pts)
7. A fragment of DNA was sequenced using dideoxy nucleotides (ddA, ddC, ddG, ddT). The
sequencing gel is shown below.
a) Deduce the nucleotide sequence using the gel below. (5pts)
Using the sequence below deduce the 8 base sequence that was used as a primer for the above
sequencing reaction. (5pts)
3’CGGGCATCGAACGGGGACCTGGAAATCTGTATCTAAAGGTCCAGGGGACGTACGC
8. Explain the concept of gene imprinting. (7pts)
9. In the article Boosting Vaccine Power what is the new approach to the production of vaccines and
why is this important? (6 pts)
10. Fill in the blanks (2 pts ea)
The full chemical name of DNA is ______________________________________.
A chart that displays all the chromosome pairs in size order is called a __________________.
_________________ are alterations in the nucleotide sequence of the DNA molecule that can occur
randomly and modify the genome.
When a protein is exposed to heat, or harsh chemicals it unfolds and is said to be__________________.
A nucleotide triplet that codes for an amino acid is known as a(n) _______________. There are three
stop codons recognized by ribosomes. The sequences of these codons are _______, ________, and
________.
_____________________ is the process of making RNA from a DNA template, where as
______________________ is the process of making protein by reading the mRNA code.
A(n) _____________________ is a change in the DNA sequence of an organism. A(n)
_________________________ is a change in the DNA sequence that does not change the structure of the
protein product.
Splicing of eukaryotic RNA molecules removes the _____________ and links together the __________
within the genetic sequence.
Sickle cell anemia is caused by a mutation in the _______________________ gene.
11. Describe what is meant by epigenetics. (6pts)
12. Use the figure at the bottom of the page to fill in the following diagram to show the products of
transcription and translation. (10 pts)