* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetics Exam 3
Genetic engineering wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Polyadenylation wikipedia , lookup
X-inactivation wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
SNP genotyping wikipedia , lookup
Neocentromere wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Human genome wikipedia , lookup
Designer baby wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Holliday junction wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA vaccination wikipedia , lookup
Genomic library wikipedia , lookup
DNA polymerase wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Genetic code wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding RNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genome editing wikipedia , lookup
Epitranscriptome wikipedia , lookup
History of RNA biology wikipedia , lookup
Microevolution wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Ethics and Genetics Exam II Name: ___________________________________________________ ID# on back of last page HONOR CODE _________________________________________________________ 1. Fill in the Blanks 2 pts each) _________________________________ A DNA sequence that is transcribed. ________________________________ Traits that show up in both sexes but are expressed differently. ______________________ __________An organism composed of two or more genetically different cell types. ________________________________ A chromosomal mutation in which there is a change in position of chromosome segments to a different location in the genome. ________________________________ A gene present in only one dose. ________________________________ An enzyme that introduces or eliminates winding of double stranded DNA. _______________________________ A dense staining structure found in the nuclei of normal mammalian females but absent in normal males. Two ways in which higher eukaryotes can become genetic mosaics are: ______________________________________ and _____________________________________. 2. Two proteins encoded by mRNA are called X and Y. At what level in the process of gene expression does regulation occur in each of the following situations? (6 pts) a) Neither nuclear nor cytoplasmic RNA can be found for either X or Y. b) Nuclear but not cytoplasmic RNA can be found for both X and Y. c) Both nuclear and cytoplasmic RNA can be found for both X and Y, but no X or Y can be found in the cell. 3. A fetus that was spontaneously aborted has a genotype of 92 total chromosomes with XXYY. What might have happened in the embryo to give rise to this genotype? (7pts) 4. The temperature at which half of the hydrogen bonds in a sample of double stranded DNA have been denatured is called the melting point, or tm. Order the following three molecules in terms of their tm (highest to lowest). Why did you list them in that order? (6pts) (a) 5' ATTCTAACTTTGAT TAAGATTGAAACTA (b) 5' CGACTGGCTAACCG GCTGACCGATTGGC (c) 5' CGCATTATTGTCCA GCGTAATAACAGGT Order of melting temp ______________________ Why? 5. What type of mutation is depicted by the following mRNA sequences? (4 pts) Wild type 5’ AAUCCUUACGGA Mutant 5’ AAUCCUACGGA 6. Multiple choice (2 pts each) _____ A sequence of DNA that reads: 5’ ATGCCTGAATCAGCTTTACAT should code for ___ amino acids after all steps of conversion into protein are complete. A) 5 B) 6 C) 7 D) 8 E) no _____ How many different amino acids could be coded for using the RNA sequence 5’ UGCUGCUGC? A) 0 B) 1 C) 2 D) 3 _____ Which chemical group is at the 5’ end of a single polynucleotide strand? A) hydroxyl group [OH] B) phosphate group [PO4] C) purine base D) ribose sugar _____ Which protein (enzyme) catalyzes the elongation of a DNA strand in the 5’–to- 3’ direction? A) RNA polymerase B) DNA elongase C) Dnase III D) DNA polymerase E) reverse transcriptase _____ If G makes up 23% of the nucleotides in a sample of double stranded DNA then T would make up what percent of the bases? A) 23% B) 77% C) 52% D) 27% E) 15% _____ When DNA replicates: A) each double stranded molecule will have one of the original parental strands and one new strand. B) one double stranded molecule will be entirely new and the other will have both original strands. C) both double stranded molecules will be entirely new and the parental molecule will be degraded. D) each strand of the double stranded molecules will have parts of the parental strand and parts of new strand. _____ The proteins that make up part of the structure of a chromosome are called A) enzymes B) nonhistones C) nucleotides D) centrosomes 7. Fill in the blanks on the table below to show the nucleotide sequences. (10pts) C DNA double helix T G A C A U mRNA transcribed Appropriate U G G G C A tRNA anticodon 8. Given the normal chromosome arrangement ABCDEFGHIJKLMN name the chromosome rearrangements listed below. (9 pts) ABCDEFHIJKLMN _____________________________ ABCDEFGHIHIHIJKLMN _____________________________ ABCDEFGHIJXYZKLMN _____________________________ 9. How many chromosomes would a person have that has Klinefelter syndrome and also trisomy 21? (6 pts) 10. Many philosophers and sociologists have argued that IVF, selective abortion, and preimplantation genetic diagnosis are modern forms of eugenics. Why do you think they are right or wrong about their beliefs? (7 pts) 11. Briefly describe the reading Disease Detector. (6 pts) 12. Would you take a drug that was prescribed for you based on your race? Cite a reason for your answer. (7 pts)