Download Genetics Exam 3

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

DNA wikipedia , lookup

Mutation wikipedia , lookup

Nucleosome wikipedia , lookup

Genetic engineering wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Messenger RNA wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Polyadenylation wikipedia , lookup

X-inactivation wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

SNP genotyping wikipedia , lookup

Neocentromere wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Human genome wikipedia , lookup

RNA wikipedia , lookup

Designer baby wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Holliday junction wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

DNA vaccination wikipedia , lookup

Genomic library wikipedia , lookup

RNA-Seq wikipedia , lookup

Chromosome wikipedia , lookup

DNA polymerase wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Genetic code wikipedia , lookup

Epigenomics wikipedia , lookup

Molecular cloning wikipedia , lookup

Non-coding RNA wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Gene wikipedia , lookup

Genome editing wikipedia , lookup

Epitranscriptome wikipedia , lookup

Genomics wikipedia , lookup

History of RNA biology wikipedia , lookup

Microevolution wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Non-coding DNA wikipedia , lookup

Point mutation wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

DNA supercoil wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Helitron (biology) wikipedia , lookup

Replisome wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Primary transcript wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Transcript
Ethics and Genetics Exam II
Name: ___________________________________________________ ID# on back of last page
HONOR CODE _________________________________________________________
1. Fill in the Blanks 2 pts each)
_________________________________ A DNA sequence that is transcribed.
________________________________ Traits that show up in both sexes but are expressed
differently.
______________________ __________An organism composed of two or more genetically different
cell types.
________________________________ A chromosomal mutation in which there is a change in
position of chromosome segments to a different location in the genome.
________________________________ A gene present in only one dose.
________________________________ An enzyme that introduces or eliminates winding of double
stranded DNA.
_______________________________ A dense staining structure found in the nuclei of normal
mammalian females but absent in normal males.
Two ways in which higher eukaryotes can become genetic mosaics are:
______________________________________ and _____________________________________.
2. Two proteins encoded by mRNA are called X and Y. At what level in the process of gene
expression does regulation occur in each of the following situations? (6 pts)
a) Neither nuclear nor cytoplasmic RNA can be found for either X or Y.
b) Nuclear but not cytoplasmic RNA can be found for both X and Y.
c) Both nuclear and cytoplasmic RNA can be found for both X and Y, but no X or Y can be found in
the cell.
3. A fetus that was spontaneously aborted has a genotype of 92 total chromosomes with XXYY.
What might have happened in the embryo to give rise to this genotype? (7pts)
4. The temperature at which half of the hydrogen bonds in a sample of double stranded DNA have
been denatured is called the melting point, or tm. Order the following three molecules in terms of
their tm (highest to lowest). Why did you list them in that order? (6pts)
(a) 5' ATTCTAACTTTGAT
TAAGATTGAAACTA
(b) 5' CGACTGGCTAACCG
GCTGACCGATTGGC
(c) 5' CGCATTATTGTCCA
GCGTAATAACAGGT
Order of melting temp ______________________
Why?
5. What type of mutation is depicted by the following mRNA sequences? (4 pts)
Wild type
5’ AAUCCUUACGGA
Mutant
5’ AAUCCUACGGA
6. Multiple choice (2 pts each)
_____ A sequence of DNA that reads: 5’ ATGCCTGAATCAGCTTTACAT should code for ___ amino
acids after all steps of conversion into protein are complete. A) 5 B) 6 C) 7 D) 8 E) no
_____ How many different amino acids could be coded for using the RNA sequence 5’ UGCUGCUGC?
A) 0 B) 1 C) 2 D) 3
_____ Which chemical group is at the 5’ end of a single polynucleotide strand? A) hydroxyl
group [OH] B) phosphate group [PO4] C) purine base D) ribose sugar
_____ Which protein (enzyme) catalyzes the elongation of a DNA strand in the 5’–to- 3’
direction? A) RNA polymerase B) DNA elongase C) Dnase III D) DNA polymerase
E) reverse transcriptase
_____ If G makes up 23% of the nucleotides in a sample of double stranded DNA then T would
make up what percent of the bases? A) 23% B) 77% C) 52% D) 27% E) 15%
_____ When DNA replicates: A) each double stranded molecule will have one of the original parental
strands and one new strand. B) one double stranded molecule will be entirely new and the other will
have both original strands. C) both double stranded molecules will be entirely new and the parental
molecule will be degraded. D) each strand of the double stranded molecules will have parts of the
parental strand and parts of new strand.
_____ The proteins that make up part of the structure of a chromosome are called A) enzymes B) nonhistones C) nucleotides D) centrosomes
7. Fill in the blanks on the table below to show the nucleotide sequences. (10pts)
C
DNA double
helix
T G A
C A
U
mRNA
transcribed
Appropriate
U G G
G C A
tRNA anticodon
8. Given the normal chromosome arrangement ABCDEFGHIJKLMN name the chromosome
rearrangements listed below. (9 pts)
ABCDEFHIJKLMN
_____________________________
ABCDEFGHIHIHIJKLMN
_____________________________
ABCDEFGHIJXYZKLMN
_____________________________
9. How many chromosomes would a person have that has Klinefelter syndrome and also trisomy 21?
(6 pts)
10. Many philosophers and sociologists have argued that IVF, selective abortion, and preimplantation genetic diagnosis are modern forms of eugenics. Why do you think they are right or
wrong about their beliefs? (7 pts)
11. Briefly describe the reading Disease Detector. (6 pts)
12. Would you take a drug that was prescribed for you based on your race? Cite a reason for your
answer. (7 pts)