Download Chem 317 Exam II

October 22nd, 2012
Name:______________________
CLID:_____________________
Score:____________________
Chem 317 Exam II
There are 17 multiple choices that are worth 3 points each.
There are 4 problems and 1 bonus problem. Try to answer the questions, which you know
first, and then solve the problems, which you are not sure about.
Here is the summary of the total 100 points and 8 bonus points. Carefully read the
questions. Good luck!
Multiple choice (17
total)
Problems #1
#2
#3
#4
#5 Bonus
Total
3 points each, total
51 points
12 points
12 points
9 points
16 points
8 points
108 points
You could use your calculator if you need.
No notes or books of any sort may be used during the exam. No cell phones.
I have neither given nor received aid on the exam.
Signature and date
________________________________________________
1
I. Multiple Choice (3 points each)
1. Restriction endonucleases type II (or restriction enzymes) are produced by microorganisms as
part of the defense system to protect themselves against invasion of foreign DNA by cleaving
_____________. The first four nucleotides of the 8-base recognition cleavage site of restriction
enzyme Not I are GCGG. The complete sequence of this 8-nucleotide recognition cleavage site is
_____________?
a) double-stranded DNA; 5’-GCGGCCGC-3’
b) double-stranded DNA; 5’-GCGGGGCG-3’
c) single-stranded DNA or double-stranded DNA; 5’-GCGGCCGC-3’
d) single-stranded DNA or double-stranded DNA; 5’-GCGGGGCG-3’
Your answer:______________
2. A DNA polymerase is an enzyme that catalyzes the polymerization of DNA into a DNA
strand using a DNA template. RNA polymerase, also known as DNA-dependent RNA
polymerase, is an enzyme that produces RNA using a DNA template. DNA polymerase requires
_____________, to initiate DNA synthesis from the direction of _____________ and RNA
polymerase does not require a primer for start of RNA synthesis from the direction of
_____________ .
a) a DNA primer, not a RNA primer; 5’ → 3’; 5’ → 3’
b) a DNA primer or a RNA primer; 5’ → 3’; 5’ → 3’
c) a DNA primer, not a RNA primer; 3’ → 5’; 3’ → 5’
d) a DNA primer or a RNA primer; 3’ → 5’; 3’ → 5’
Your answer:______________
3. A cDNA synthesis starts with the mRNA extracted from a specific tissue or cell type from an
organism. In order to generate a cDNA from a mRNA, four enzymes are generally required. The
correct sequence of these four enzymes in generating cDNA using mRNA as a template is
______________.
a) reverse transcriptase Æ DNA polymerase Æ RNase H Æ S1 nuclease
b) reverse transcriptase Æ RNase H Æ DNA polymerase Æ S1 nuclease
c) reverse transcriptase Æ RNase H Æ S1 nuclease Æ DNA polymerase
d) RNase H Æ reverse transcriptase Æ S1 nuclease Æ DNA polymerase
Your answer:______________
4. A virus X that infects roaches is purified and the nucleic acid fraction is hydrolyzed and
analyzed. The nucleotide composition of virus X is found to be 22% A : 28% C : 28%G : 22% T.
A virus Y that infects zebrafish is purified and nucleic acid fraction is hydrolyzed and analyzed
too. The nucleotide composition of virus Y is found to be 32% A : 18% C : 32% G : 18% U.
Based on the information, what are the forms of the genomes of the viruses X and Y respectively?
a) single-stranded DNA; single-stranded RNA
b) double-stranded DNA; single-stranded RNA
c) single-stranded DNA; double-stranded RNA
d) double-stranded DNA; double-stranded RNA
Your answer:______________
2
5. DNA is typically a double stranded helix. The linkage between two adjacent nucleotides is
through a ___________. What is the nucleotide sequence of the DNA strand that is
complementary to 5’-ATTCCGGACT-3’?
a) 3’ to 5’ phosphodiester bond; 5’-AGTCCGGAAT-3’
b) 3’ to 5’ phosphodiester bond; 5’-TAAGGCCTGA-3’
c) 5’ to 3’ phosphodiester bond; 5’-AGTCCGGAAT-3’
d) 5’ to 3’ phosphodiester bond; 5’-TAAGGCCTGA-3’
Your answer:______________
Reaction ddT
Reaction ddC
Reaction ddG
gel electrophoresis
Reaction ddA
6. You are using a dideoxy sequencing method to sequence a DNA fragment. A sequence gel
gives the following data. The sequence of the DNA fragment is _____________ and the
nucleotide mixture in the reaction ddA contains _____________ .
a) 5’-TAGAACGCT-3’; dATP, dGTP, dCTP, dTTP, ddATP
b) 5’-TAGAACGCT-3’; ddATP, dGTP, dCTP, dTTP
c) 5’-TCGCAAGAT-3’; dATP, dGTP, dCTP, dTTP, ddATP
d) 5’-TCGCAAGAT-3’; ddATP, dGTP, dCTP, dTTP
Your answer:______________
7. Two proteins are said to be homologous if they have been derived from a common ancestor.
___________ are homologs that are present within one species with ___________ functions;
___________ are homologs that are present within different species with ___________ functions.
a) Orthologs; similar or identical; Paralogs; similar or different
b) Orthologs; similar or different; Paralogs; similar or identical
c) Paralogs; similar or identical; Orthologs; similar or different
d) Paralogs; similar or different; Orthologs; similar or identical
Your answer:______________
3
8. Bioinformatics is to study DNA, RNA and protein sequences through a combination of
biochemistry, computer science and statistics approaches and to convert sequence information
into knowledge. The bioinformatics concepts we have discussed in class include convergent
evolution (A), divergent evolution (B), orthologs (C) and paralogs (D). Match all their possible
example(s) (1, 2, 3) with each of the bioinformatics concepts (A, B, C, D). For example: A:1
means that 1 matches with A.
Bioinformatics Concepts
A: Convergent evolution
B: Divergent evolution
C: Orthologs
D: Paralogs
Examples
1: Human Ribonuclease and Human Angiogenin
2: Chymotrypsin and Subtilisin
3: Human Ribonuclease and Bovine Ribonuclease
a) A: 1; B: 2 and 3; C: 1; D: 3
b) A: 2; B: 1 and 3; C: 1; D: 3
c) A: 1; B: 2 and 3; C: 3; D: 1
d) A: 2; B: 1 and 3; C: 3; D: 1
Your answer:______________
9. In Chapter 6, we have discussed protein sequence and structure relations. Match all possible
example(s) (1, 2, 3, 4, 5) with each of the following statements on protein sequence and structure
(A, B, C). For example: A:1 means that 1 matches with A.
Statements on Protein Sequence and Structure
A. Two proteins have very similar amino acid sequences, and both have similar 3D structures.
B. Two proteins have very different amino acid sequences, however, both have similar 3D
structures.
C. Two proteins have very different 3D structures, however, both have similar active sites
Examples
1. Actin and Hsp70
2. Chymotrypsin and Subtilisin
3. Human Ribonuclease and Human Angiogenin
4: Human Hemoglobin and Human Myoglobin
5: Human Ribonuclease and Bovine Ribonuclease
a) A: 3, 4 and 5; B: 1; C: 2
b) A: 3, 4 and 5; B: 2; C: 1
c) A: 4 and 5; B: 1; C: 2 and 3
d) A: 4 and 5; B: 2; C: 1 and 3
Your answer:______________
4
10. Bioinformatics study is to protein relation. Below are segments of the sequences of
cytochrome C from species A, B, C, D and E. These sequences correspond to the C-terminal 25
residues of the proteins. The different amino acids are underlined.
MVFVGLKKPEERADLIAYLKKATSS (species X1)
MVFVGLLKPEERADLIAYLKKATSS (species X2)
MVFVGLEKPEERADLIAYLKKATSS (species X3)
MVFVGLRKPEERADLIAYLKKATSS (species X4)
MVFVGLFKPEERADLIAYLKKATSS (species X5)
The order of the closeness from high to low of species of X2, X3, X4 and X5 to species X1 is
___________ . These sequences are examples of C, ___________ (choose all that apply).
A. orthologs
B. paralogs
C. homologs
D. convergent evolution
E. divergent evolution
a) X4 > X2 > X5 > X3; A, and E
b) X4 > X2 > X5 > X3; B, and D
c) X4 > X3 > X2 > X5; A, and E
d) X4 > X3 > X2 > X5; B, and D
Your answer:______________
11. A virus causes Acquired Immunodeficiency Syndrome (AIDS). It was first exposed in 1981
in central Africa. More than 25 million HIV patients were dead by 2006 and 45 million people
are estimated to be infected by HIV. What is the correct order of viral proteins in HIV life cycle
from the first to last step?
a) protease → reverse transcriptase → DNA polymerase → integrase
b) reverse transcriptase → DNA polymerase → integrase → protease
c) reverse transcriptase → integrase → DNA polymerase → protease
d) reverse transcriptase → DNA polymerase → protease → integrase
Your answer:______________
12. Transcription is the process where a portion of the DNA molecule is copied. This coded
information is then translated to create proteins the cell can use. Transcription process of
eukaryotic cells differs from prokaryotic cells in several ways. Conversion of heterogeneous
RNAs (hnRNAs) of eukaryotic cells to mature mRNA requires several post-transcriptional
modifications (Modifications occur after hnRNAs have been generated) while prokaryotic RNAs
do not have those modifications. The correct order of post-transcriptional modifications of
eukaryotic RNAs are _____________ .
a) 5’-capping by m7G → A poly A tail at the 3’-end → RNA splicing
b) A poly A tail at the 3’-end → 5’-capping by m7G → RNA splicing
c) RNA splicing → 5’-capping by m7G → A poly A tail at the 3’-end
d) RNA splicing → A poly A tail at the 3’-end5’ → -capping by m7G
Your answer:______________
5
13. Sickle-cell anemia arises from a mutation in the gene for the β chain of human hemoglobin.
The change from GAG codon to GTG codon in the mutant eliminates a cleavage site for type II
restriction enzyme Mst II, which recognizes the target sequence CCTGAGG. These finding form
the biochemical basis of a diagnostic test for the sickle-gene. A rapid procedure for
distinguishing between the normal and the mutant genes has been developed. The procedure
involves three major steps A, B and C:
A. Enzyme Mst II cleavage
B. Gel electrophoresis
C. PCR
The correct order of those steps for this procedure is _____________ . You expect to see
____________ DNA fragment(s) in normal people and ____________ DNA fragment(s) in
sickle-cell disease patient from gel electrophoresis.
a) Enzyme Mst II cleavage → Gel Electrophoresis → PCR; two; one
b) Enzyme Mst II cleavage → Gel Electrophoresis → PCR; one; two
c) PCR → Enzyme Mst II cleavage → Gel Electrophoresis; two; one
d) PCR → Enzyme Mst II cleavage → Gel Electrophoresis; one; two
Your answer:______________
14. Insulin is a hormone secreted by the pancreas in response to lower blood glucose levels.
Diabetes patients need insulin. You are in the process to express human insulin in bacterial E.
coli cells. Based on your knowledge, the correct sequence of the major steps and reagents for this
process is _____________.
a) mRNA extraction Æ PCR Æ cDNA generation Æ restriction enzyme Æ DNA ligase Æ
expression system construction
b) mRNA extraction Æ cDNA generation Æ restriction enzyme Æ DNA ligase Æ PCR Æ
expression system construction
c) mRNA extraction Æ cDNA generation Æ PCR Æ restriction enzyme Æ DNA ligase Æ
expression system construction
d) cDNA generation Æ mRNA extraction Æ PCR Æ expression system construction Æ
restriction enzyme Æ DNA ligase
Your answer:______________
15. Genetic information flows from DNA to RNA and then from RNA to protein. The following
duplex DNA is transcribed from right to left and is printed here.
5’-TCTGACTATTCAGCTCTC-3’
3’-AGACTGATAAGTCGAGAG-5’
The template strand of this duplex DNA is _____________ and the amino acid sequence of the
polypeptide that this DNA sequence encodes is _____________? Assuming that transcription
starts from the first nucleotide. The genetic codes are in the last page of the test. You can tear it
off for your convenience.
a) 5’-TCTGACTATTCAGCTCTC-3’; Ser-Asp-Tyr-Ser-Ala-Leu
b) 3’-AGACTGATAAGTCGAGAG-5’; Leu-Ala-Ser-Tyr-Asp-Ser
c) 5’-TCTGACTATTCAGCTCTC-3’; Leu-Ala-Ser-Tyr-Asp-Ser
d) 3’-AGACTGATAAGTCGAGAG-5’; Ser-Asp-Tyr-Ser-Ala-Leu
Your answer:______________
6
16. Nucleases can be divided into several classes. The nucleotide cleavage sites (the arrows) of
the enzymes A and B are shown in the following diagram.
Enzyme B
A
P
G
P
C
P
T
P
G
P
OH
Enzyme A
Both enzyme A and B are DNases. Enzyme A is also ______________ and enzyme B is
______________ too.
a) an endonuclease, a nuclease a; an exonuclease, a nuclease b
b) an endonuclease, a nuclease b; an exonuclease, a nuclease a
c) an exonuclease, a nuclease a; an endonuclease, a nuclease b
d) an exonuclease, a nuclease b; an endonuclease, a nuclease a
Your answer:______________
17. DNA double helix model was proposed by James Watson and Francis Crick. They both
obtained Nobel Prize in 1953 by discovering DNA double helix model.
The following is a list of specific non-covalent interactions.
A. Base stacking through π-π interactions
B. Electrostatic interactions between positive ions and phosphate groups
C. Hydrogen bonds between base pairs
D. Hydrogen bonds between bases and water molecules
E. Hydrogen bonds between sugar-phosphate backbond and water molecules
DNA double helix structure in a water solution is maintained by _____________.
a) A, B, C, D, and E
b) A, B, C and D, but most likely not E
c) A, B, C and E, but most likely not D
d) Only C
Your answer:______________
7
II. Problems
1. DNA sequencing: the following DNA fragment was analyzed by the dideoxy method. The
primer is used for DNA sequencing is shown below.
primer
5’3’
3’GCTAACCT-5’ (template strand)
A sample of the DNA was reacted with DNA polymerase and each of the nucleotide mixtures (in
an appropriate buffer) list below. Concentration of each nucleotide in the mixture is the same.
1. dATP, dTTP, dCTP, dGTP, ddTTP
2. ATP, TTP, CTP, GTP, dGTP
3. dATP, dTTP, dCTP, ddCTP; ddGTP
4. dATP, dTTP, dCTP, dGTP
The resulting DNA was separated by electrophoresis on an agarose gel and the bands on the gel
were located. Draw each band in lane 1, 2, 3 and 4. You are not required to explain your answers.
(12 points)
2
3
4
gel electrophoresis
1
8
2. Each protein has its unique function and each RNA has its own function. Match the following
functions or processes or interactions numbered from 1 to 16 with their corresponding proteins or
RNAs listed from A to J. You need to match the number(s) with their corresponding proteins or
RNAs by filling out the blanks with your answers. You are not required to explain your answers.
It is possible that some functions, or processes or interactions may not have their matches. (12
points) (12 points)
Functions or Processes or Interactions
1. Bind promoter containing -25 sequence
2. Bind promoter containing -35 sequence
3. Bind mRNA at its 5’-untranslated region
4. Cleave peptide bonds
5. Cleave phosphodiester bonds
6. Function in RNA splicing
7. Function in mRNA degradation
8. Function in DNA repair
9. Function in transcription termination
10. Function in translation termination
11. Function in muscle movement
12. Function in assisting protein folding
13. Interact with CD4 receptor
14. Interact with CD4 ligand
15. Is a cytoskeleton component
16. Stimulate blood vessel growth
Proteins
A: Actin
B: Angiogenin
C: Eukaryotic RNA polymerase
D: HSP70
E: gp120
F: Nucleases
G: Rho
H: Ribosome
I: Small non-coding RNA
J: Substilisin
Your answers (your match)
9
3. Plasmids are naturally occurring extrachromsomal circular double-stranded DNA. They are
important in DNA recombination technology. (total 9 points)
(a) What are the features of plasmid? You are not required to explain the features. (3 points)
(b) What is(are) requirement(s) for a plasmid to replicate itself in both E. coli cells and yeast
cells? Use 25 words or less. (2 points)
(c) You have a plasmid with ampicillin resistance in E. coli cells. But, ampicillin resistance
seems disappeared when you transformed the same plasmid into yeast cells. List two possible
reasons for this observation and justify your answer. (4 points)
10
4. Huntington’s disease (HD) is an inherited neurodegenerated disorder characterized by the
gradual, irreversible impairment of psychological, motor and cognitive functions. The molecular
basis of the disease is becoming better understood. The genetic mutation underlying HD has
been traced to a gene encoding a protein of unknown function. In individuals who will not
develop HD, a region of the gene that encodes the amino terminus of the protein has a sequence
of CAG codon for glutamine (Gln, Q) that is repeated 6 to 39 times in succession. In individuals,
with adult-onset HD, this codon is typically repeated 40 to 55 times.
A small portion of the amino acid-terminal coding sequence of HD gene is given below. The
nucleotide sequence (5’ → 3’) of the DNA is shown in italic, the amino acid sequence
corresponding to the gene is shown under the nucleotide sequence and CAG repeat is highlighted
in bold and underlined. (total 16 points)
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCC
M A T L E K L M K A F E S
CTCAAGTCCTTCCAGCAGCAGCAGCAGCAGCAGCAGCAG
L K S F Q Q Q Q Q Q Q Q Q
CAGCAGCAGCAGCAGCAGCAGCCGCCACTTCCG
Q Q Q Q Q Q Q P P L P
(a) Design a sense primer and an anti-sense primer to amply the exact CAG repeat in the diagram
above. Each of the primers must be 6-nucleotide long. Write nucleotide sequences of the sense
primer and the anti-sense primer from 5’ to 3’. You are not required to explain it. (4 points)
The sequence of the sense primer from 5’ to 3’: ____________________________
The sequence of the anti-sense primer from 5’ to 3’: ____________________________
(b) What will be the size of PCR products in base pair (bp) for a normal person and a HD patient
using 6-nucleotide sense and anti-sense primers? Assuming that the normal person has 23 CAG
repeats and the HD patient has 48 repeats. Show your calculations or explain it. (4 points)
(c) Assuming that you have 10 copies of double-stranded DH gene and are supplied with Taq
DNA polymerase, dNTPs, sense and anti-sense primers, and all other reagents necessary. How
many double-stranded copies of HD gene if you use 10 double-stranded HD genes as templates
after 20 cycles? You are not required to explain your answer. But you need to show your
calculations. (4 points)
11
(d) Assuming that you have 10 copies of single-stranded HD gene and are supplied with Taq
DNA polymerase, dNTPs, sense and anti-sense primers, and all other reagents necessary. How
many double-stranded copies of HD gene if you use 10 single-stranded HD genes as templates
after 20 cycles? You are not required to explain your answer. But you need to show your
calculations. (4 points)
5. Bonus question (8 points)
(a) DNA polymerase has a proofreading activity that correct wrong nucleotides added by mistake
of the enzyme. Unlike DNA polymerase, RNA polymerase does not have the proofreading
activity. Explain why the lack of proofreading activity of RNA polymerase is not detrimental to
the cells. (4 points)
(b) What will happen to DNA replication and transcription if the following molecule is added to
the cells? Justify your answer. (4 points)
12
13