Download Mutation detection and correction experiments in

University of Groningen
Mutation detection and correction experiments in epidermolysis bullosa simplex
Schuilenga-Hut, Petra Henriette Lidia
IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to
cite from it. Please check the document version below.
Document Version
Publisher's PDF, also known as Version of record
Publication date:
2002
Link to publication in University of Groningen/UMCG research database
Citation for published version (APA):
Schuilenga-Hut, P. H. L. (2002). Mutation detection and correction experiments in epidermolysis bullosa
simplex s.n.
Copyright
Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the
author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).
Take-down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the
number of authors shown on this cover page is limited to 10 maximum.
Download date: 18-06-2017
Chapter 5
Persistent failures in gene repair
Gerrit van der Steege1*, Petra H.L. Schuilenga-Hut2*, Hendri H. Pas1,
Charles H.C.M. Buys2, Hans Scheffer2, and Marcel F. Jonkman1
1
Dept. of Dermatology, University Hospital Groningen, Groningen, The Netherlands
2
Dept. of Medical Genetics, University of Groningen, Groningen, The Netherlands
*The authors contributed equally to this study.
Published as a correspondence in Nature Biotechnology (2001) 19:305-306
71
Chapter 5
To the editor:
Several recent reports describe the use of chimeric RNA/DNA oligonucleotides
(RDOs) to alter DNA sequences. This targeted gene correction strategy, also called
chimeraplasty, initially was shown to change episomal sequences (Yoon et al.,
1996), but various examples of altering genomic sequences in both mammalian
(Alexeev & Yoon, 1998; Cole et al., 1996; Kren et al., 1998; Kren et al., 1997) and
plant cell systems (Beetham et al., 1999; Zhu et al., 1999) have since been
described. DNA sequence alterations have also been achieved in nuclear or cell-free
extracts (Cole et al., 1999; Igoucheva et al., 1999). This novel RDO technology holds
promise as a means to correct point mutations in disease genes and would have
several advantages over conventional gene therapy strategies relying on gene
addition. Although the number of papers reporting successful usage of the RDO
technology is slowly growing, the number of independent groups from which these
studies derive does not.
The basic design of a chimeric oligonucleotide is the same in all studies: doublehairpin folded 68-mers with a chimeric DNA and 2’-O-methyl RNA backbone. The
ability to form intramolecular hybrids should protect the RDOs against cellular
exonucleases; the RNA residues are methylated, which also prevents degradation.
Once transported into the nucleus, the RDO is thought to bind to the DNA target on
the basis of a homology region 25 base pairs in length. It is postulated that the
presence of the RNA residues makes base pairing more effective. Recombinase
activity may then form intermediate structures, and non-matching base pairs are
assumed to attract the mismatch-repair protein machinery. The exact mechanism of
RDO-mediated sequence exchange, however, is still unknown and needs to be
clarified.
Two recent reports describe modifications of the original RDO design and its
effects as measured by in vitro reactions in nuclear extracts (Gamper et al., 2000;
Igoucheva et al., 1999). These studies indicate that a mismatching base in the allDNA strand alone is capable of inducing sequence exchange, whereas a sole
72
Failures in gene repair
mismatch in the RNA residue-containing strand is not. It was also observed that 68mers only consisting of DNA residues could alter sequences in vitro, whereas the
same constructs failed in vivo.
To investigate the potential of chimeric oligonucleotides in the therapy of
heritable skin diseases, we have studied RDO technology in immortalised
keratinocytes derived from two patients with epidermolysis bullosa who had
homozygous mutations in the keratin 14 (KRT14) and the type XVII collagen gene
(COL17A1), respectively (Fig. 1). Both mutations result in absence of the
corresponding proteins. Therefore, our immunofluorescence microscopy-based
assay system, which uses specific monoclonal antibodies for detecting corrected
cells, is of very high sensitivity. For both lines, we established efficient transfection
protocols by testing several transfection agents and monitoring the nuclear uptake of
fluorescently labelled oligonucleotides by laser-scanning fluorescence microscopy.
Over an extended period of time, we carried out several RDO transfection-correction
experiments with both the keratinocyte cell lines. These also included experiments
with UVB-irradiated cells in an attempt to activate the DNA repair machinery.
To date, no mutation corrections have been observed. Attempts to alter the
same epidermolysis bullosa genes in lymphocytes also failed. In addition, efforts to
reproduce RDO experiments described in the literature, such as β-globin in
lymphocytes and coagulation factor IX in liver cells, have also been unsuccessful. In
these latter cases, however, the less sensitive PCR/restriction-fragment-length
polymorphism analysis system was used to detect sequence alterations.
73
Chapter 5
C17-RDO (Col17A1)
del
intron 29
↓ exon 30
5’ agagaccttgcttctactttaccagGTCCTGCTG gCCCAGACGGACACCAAGGCCCAAGAGGTTGGTCAC
3’ tctctggaacgaagatgaaatggtcCAGGACGAC cGGGTCTGCCTGTGGTTCCGGGTTCTCCAACCAGTG
T
T
TGCGCG-guccaggacgACCGGgucugccuguT
T
T
TCGCGC CAGGTCCTGCTG GCCCAGACGGACAT
5'
K14-RDO (KRT14)
mut
intron 1
exon 2
↓
1810
1820
1830
1840
1850
1860
1870
5’ agtccatttgacaaattacctgtgccttttccatcctgc c gATTCTCACAGCCACAGTGGACAATGCCAA
3’ tcaggtaaactgtttaatggacacggaaaaggtaggacg g cTAAGAGTGTCGGTGTCACCTGTTACGGTT
TGCGCG-aaagguaggaCGTCTaagagugucgT
T
T
T
T
TCGCGC TTTCCATCCTGC AGATTCTCACAGCT
5'
Figure 1 Sequences of the genomic targets and the RDOs used in the keratinocyte correction
experiments. The cell line with the COL17A1 mutation (upper panel) is homozygously deleted
for a GC basepair at position 2342 (GenBank accession no. M91669), leading to absence of
type XVII collagen. The 68-mer C17-RDO sequence is designed to align with the genomic
sequence around the mutated position and to re-introduce the deleted base pair. The keratin
14 cell line carries a homozygous mutation in the 3’ splice site of intron 1 of KRT14, leading to
aberrant splicing and truncated, if any, protein. The K14-RDO should correct the mutated
base pair. Intronic sequences in the genomic targets are presented in lower case, exonic
sequences in higher case. The 2’-O-Methyl-RNA residues in the RDOs are given in
lowercase; DNA residues are in higher case.
Nevertheless, during a working visit to Kyonggeun Yoon’s laboratory at Thomas
Jefferson University (Philadelphia, PA), one of us (G. van der Steege) has obtained
limited success with a melanocyte cell line derived from an albino mouse and an
RDO designed to correct a mutation in the tyrosinase gene. Yoon and colleagues,
who are gratefully acknowledged, have successfully applied the RDO technology in
74
Failures in gene repair
several cell systems, including this albino melanocyte cell line (Alexeev et al., 2000;
Alexeev & Yoon, 1998). The above mentioned correction of the tyrosinase mutation
occurred only once in a particular series of five experiments, as demonstrated by
pigmentation of a couple of cells in the culture dish. This success was achieved with
an RDO synthesised by Eurogentec (Seraing, Belgium), our regular supplier of
RDOs. This particular experiment thus validated the quality of the RDOs derived
from Eurogentec. An unexpectedly high variability of correction frequencies with the
melanocyte line has been described but, despite using the very same cell line and
RDO, we were in all our attempts thus far unable to reproduce any positive result in
our laboratory in Groningen.
The reasons for the persistent failure of the RDO technology are unknown.
Insufficient quality of the synthesised RDO is unlikely to be the major problem, in
view of the tyrosinase correction results. A good RDO quality (e.g., correct synthesis
length and purity) is an obvious prerequisite, but poor RDO quality cannot entirely
explain the lack of success experienced by others and us. It may be that the choice
of keratinocytes as the study system is not optimal. Variation among cell types and a
lower responsiveness of keratinocytes with respect to RDO-mediated sequence
changes have been described (Santana et al., 1998). However, this does not explain
the failure to be complete, as an ‘all-or-nothing’ principle in this is unlikely. Our
ongoing experiments include in vitro reactions using nuclear extracts and the
development of a mutated reporter gene system, enabling sensitive monitoring of
correction frequencies in different cell lines and systems. However, preliminary
results with this latter, sensitive system, used to study episomal correction in CHO
cells, also indicate complete failure of the RDO technology.
We believe that the persistent failure to implement the RDO technology is
noteworthy. The complete lack of success hampers further studies and frustrates the
usage of this theoretically tempting method. We would like to stress that, despite our
disappointing experiences, we do not denounce the RDO technology as being
invalid or objectionable. However, it may be of general concern, that a broad
application of this technique is still to be awaited, despite the number and the extent
of positive reports, especially of some in vivo studies (Bartlett et al., 2000; Kren et
75
Chapter 5
al., 1999; Rando et al., 2000). An international collaboration with free exchange of
results, cell lines, and RDOs, may not only speed up the elucidation of the still
unknown mechanism behind RDO-mediated sequence change, but also prove (or
disapprove) its applicability. Such a call for a ‘chimeraplasty consortium’ of course
includes an appeal to ‘the happy few’ who have positive experiences with this
technology to participate.
References
Alexeev, V., Igoucheva, O., Domashenko, A., Cotsarelis, G., & Yoon, K. (2000) Localized in
vivo genotypic and phenotypic correction of the albino mutation in skin by RNA-DNA
oligonucleotide. Nat.Biotechnol. 18, 43.
Alexeev, V. & Yoon, K. (1998) Stable and inheritable changes in genotype and phenotype of
albino melanocytes induced by an RNA-DNA oligonucleotide. Nat.Biotechnol. 16, 1343.
Bartlett, R.J., Stockinger, S., Denis, M.M., Bartlett, W.T., Inverardi, L., Le, T.T., Man, t.N.,
Morris, G.E., Bogan, D.J., Metcalf-Bogan, J., & Kornegay, J.N. (2000) In vivo targeted
repair of a point mutation in the canine dystrophin gene by a chimeric RNA/DNA
oligonucleotide. Nat.Biotechnol. 18, 615.
Beetham, P.R., Kipp, P.B., Sawycky, X.L., Arntzen, C.J., & May, G.D. (1999) A tool for
functional plant genomics: chimeric RNA/DNA oligonucleotides cause in vivo gene-specific
mutations. Proc.Natl.Acad.Sci. USA 96, 8774.
Cole, S.A., Gamper, H., Holloman, W.K., Munoz, M., Cheng, N., & Kmiec, E.B. (1999)
Targeted gene repair directed by the chimeric RNA/DNA oligonucleotide in a mammalian
cell-free extract. Nucleic.Acids.Res. 27, 1323.
Cole, S.A., Yoon, K., Xiang, Y., Byrne, B.C., Rice, M.C., Gryn, J., Holloman, W.K., & Kmiec,
E.B. (1996) Correction of the mutation responsible for sickle cell anemia by an RNA-DNA
oligonucleotide. Science 273, 1386.
Gamper, H.B., Cole, S.A., Metz, R., Parekh, H., Kumar, R., & Kmiec, E.B. (2000) A plausible
mechanism for gene correction by chimeric oligonucleotides. Biochemistry 39, 5808.
Igoucheva, O., Peritz, A.E., Levy, D., & Yoon, K. (1999) A sequence-specific gene correction
by an RNA-DNA oligonucleotide in mammalian cells characterized by transfection and
nuclear extract using a LacZ shuttle system. Gene Ther. 6, 1960.
76
Failures in gene repair
Kren, B.T., Bandyopadhyay, P., & Steer, C.J. (1998) In vivo site-directed mutagenesis of the
factor IX gene by chimeric RNA/DNA oligonucleotides. Nat.Med. 4, 285.
Kren, B.T., Cole, S.A., Kmiec, E.B., & Steer, C.J. (1997) Targeted nucleotide exchange in the
alkaline phosphatase gene of HuH-7 cells mediated by a chimeric RNA/DNA
oligonucleotide. Hepatology 25, 1462.
Kren, B.T., Parashar, B., Bandyopadhyay, P., Chowdhury, N.R., Chowdhury, J.R., & Steer,
C.J. (1999) Correction of the UDP-glucuronosyltransferase gene defect in the gunn rat
model of crigler-najjar syndrome type I with a chimeric oligonucleotide. Proc.Natl.Acad.Sci.
USA 96, 10349.
Rando, T.A., Disatnik, M.H., & Zhou, L.Z. (2000) Rescue of dystrophin expression in mdx
mouse muscle by RNA/DNA oligonucleotides. Proc.Natl.Acad.Sci. USA 97, 5363.
Santana, E., Peritz, A.E., Iyer, S., Uitto, J., & Yoon, K. (1998) Different frequency of gene
targeting events by the RNA-DNA oligonucleotide among epithelial cells. J.Invest.Dermatol.
111, 1172.
Yoon, K., Cole-Strauss, A., & Kmiec, E.B. (1996) Targeted gene correction of episomal DNA
in mammalian cells mediated by a chimeric RNA.DNA oligonucleotide. Proc.Natl.Acad.Sci.
USA 93, 2071.
Zhu, T., Peterson, D.J., Tagliani, L., St, C.G., Baszczynski, C.L., & Bowen, B. (1999) Targeted
manipulation of maize genes in vivo using chimeric RNA/DNA oligonucleotides.
Proc.Natl.Acad.Sci. USA 96, 8768.
77
78