* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Mutation detection and correction experiments in
DNA supercoil wikipedia , lookup
Genome evolution wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Human genome wikipedia , lookup
Gene expression profiling wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Metagenomics wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Transposable element wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenetics of human development wikipedia , lookup
DNA vaccination wikipedia , lookup
History of RNA biology wikipedia , lookup
Genetic engineering wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Oncogenomics wikipedia , lookup
Epigenomics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Gene therapy wikipedia , lookup
Non-coding RNA wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Frameshift mutation wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
RNA silencing wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microsatellite wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Primary transcript wikipedia , lookup
History of genetic engineering wikipedia , lookup
Designer baby wikipedia , lookup
Genome editing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Point mutation wikipedia , lookup
University of Groningen Mutation detection and correction experiments in epidermolysis bullosa simplex Schuilenga-Hut, Petra Henriette Lidia IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2002 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Schuilenga-Hut, P. H. L. (2002). Mutation detection and correction experiments in epidermolysis bullosa simplex s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date: 18-06-2017 Chapter 5 Persistent failures in gene repair Gerrit van der Steege1*, Petra H.L. Schuilenga-Hut2*, Hendri H. Pas1, Charles H.C.M. Buys2, Hans Scheffer2, and Marcel F. Jonkman1 1 Dept. of Dermatology, University Hospital Groningen, Groningen, The Netherlands 2 Dept. of Medical Genetics, University of Groningen, Groningen, The Netherlands *The authors contributed equally to this study. Published as a correspondence in Nature Biotechnology (2001) 19:305-306 71 Chapter 5 To the editor: Several recent reports describe the use of chimeric RNA/DNA oligonucleotides (RDOs) to alter DNA sequences. This targeted gene correction strategy, also called chimeraplasty, initially was shown to change episomal sequences (Yoon et al., 1996), but various examples of altering genomic sequences in both mammalian (Alexeev & Yoon, 1998; Cole et al., 1996; Kren et al., 1998; Kren et al., 1997) and plant cell systems (Beetham et al., 1999; Zhu et al., 1999) have since been described. DNA sequence alterations have also been achieved in nuclear or cell-free extracts (Cole et al., 1999; Igoucheva et al., 1999). This novel RDO technology holds promise as a means to correct point mutations in disease genes and would have several advantages over conventional gene therapy strategies relying on gene addition. Although the number of papers reporting successful usage of the RDO technology is slowly growing, the number of independent groups from which these studies derive does not. The basic design of a chimeric oligonucleotide is the same in all studies: doublehairpin folded 68-mers with a chimeric DNA and 2’-O-methyl RNA backbone. The ability to form intramolecular hybrids should protect the RDOs against cellular exonucleases; the RNA residues are methylated, which also prevents degradation. Once transported into the nucleus, the RDO is thought to bind to the DNA target on the basis of a homology region 25 base pairs in length. It is postulated that the presence of the RNA residues makes base pairing more effective. Recombinase activity may then form intermediate structures, and non-matching base pairs are assumed to attract the mismatch-repair protein machinery. The exact mechanism of RDO-mediated sequence exchange, however, is still unknown and needs to be clarified. Two recent reports describe modifications of the original RDO design and its effects as measured by in vitro reactions in nuclear extracts (Gamper et al., 2000; Igoucheva et al., 1999). These studies indicate that a mismatching base in the allDNA strand alone is capable of inducing sequence exchange, whereas a sole 72 Failures in gene repair mismatch in the RNA residue-containing strand is not. It was also observed that 68mers only consisting of DNA residues could alter sequences in vitro, whereas the same constructs failed in vivo. To investigate the potential of chimeric oligonucleotides in the therapy of heritable skin diseases, we have studied RDO technology in immortalised keratinocytes derived from two patients with epidermolysis bullosa who had homozygous mutations in the keratin 14 (KRT14) and the type XVII collagen gene (COL17A1), respectively (Fig. 1). Both mutations result in absence of the corresponding proteins. Therefore, our immunofluorescence microscopy-based assay system, which uses specific monoclonal antibodies for detecting corrected cells, is of very high sensitivity. For both lines, we established efficient transfection protocols by testing several transfection agents and monitoring the nuclear uptake of fluorescently labelled oligonucleotides by laser-scanning fluorescence microscopy. Over an extended period of time, we carried out several RDO transfection-correction experiments with both the keratinocyte cell lines. These also included experiments with UVB-irradiated cells in an attempt to activate the DNA repair machinery. To date, no mutation corrections have been observed. Attempts to alter the same epidermolysis bullosa genes in lymphocytes also failed. In addition, efforts to reproduce RDO experiments described in the literature, such as β-globin in lymphocytes and coagulation factor IX in liver cells, have also been unsuccessful. In these latter cases, however, the less sensitive PCR/restriction-fragment-length polymorphism analysis system was used to detect sequence alterations. 73 Chapter 5 C17-RDO (Col17A1) del intron 29 ↓ exon 30 5’ agagaccttgcttctactttaccagGTCCTGCTG gCCCAGACGGACACCAAGGCCCAAGAGGTTGGTCAC 3’ tctctggaacgaagatgaaatggtcCAGGACGAC cGGGTCTGCCTGTGGTTCCGGGTTCTCCAACCAGTG T T TGCGCG-guccaggacgACCGGgucugccuguT T T TCGCGC CAGGTCCTGCTG GCCCAGACGGACAT 5' K14-RDO (KRT14) mut intron 1 exon 2 ↓ 1810 1820 1830 1840 1850 1860 1870 5’ agtccatttgacaaattacctgtgccttttccatcctgc c gATTCTCACAGCCACAGTGGACAATGCCAA 3’ tcaggtaaactgtttaatggacacggaaaaggtaggacg g cTAAGAGTGTCGGTGTCACCTGTTACGGTT TGCGCG-aaagguaggaCGTCTaagagugucgT T T T T TCGCGC TTTCCATCCTGC AGATTCTCACAGCT 5' Figure 1 Sequences of the genomic targets and the RDOs used in the keratinocyte correction experiments. The cell line with the COL17A1 mutation (upper panel) is homozygously deleted for a GC basepair at position 2342 (GenBank accession no. M91669), leading to absence of type XVII collagen. The 68-mer C17-RDO sequence is designed to align with the genomic sequence around the mutated position and to re-introduce the deleted base pair. The keratin 14 cell line carries a homozygous mutation in the 3’ splice site of intron 1 of KRT14, leading to aberrant splicing and truncated, if any, protein. The K14-RDO should correct the mutated base pair. Intronic sequences in the genomic targets are presented in lower case, exonic sequences in higher case. The 2’-O-Methyl-RNA residues in the RDOs are given in lowercase; DNA residues are in higher case. Nevertheless, during a working visit to Kyonggeun Yoon’s laboratory at Thomas Jefferson University (Philadelphia, PA), one of us (G. van der Steege) has obtained limited success with a melanocyte cell line derived from an albino mouse and an RDO designed to correct a mutation in the tyrosinase gene. Yoon and colleagues, who are gratefully acknowledged, have successfully applied the RDO technology in 74 Failures in gene repair several cell systems, including this albino melanocyte cell line (Alexeev et al., 2000; Alexeev & Yoon, 1998). The above mentioned correction of the tyrosinase mutation occurred only once in a particular series of five experiments, as demonstrated by pigmentation of a couple of cells in the culture dish. This success was achieved with an RDO synthesised by Eurogentec (Seraing, Belgium), our regular supplier of RDOs. This particular experiment thus validated the quality of the RDOs derived from Eurogentec. An unexpectedly high variability of correction frequencies with the melanocyte line has been described but, despite using the very same cell line and RDO, we were in all our attempts thus far unable to reproduce any positive result in our laboratory in Groningen. The reasons for the persistent failure of the RDO technology are unknown. Insufficient quality of the synthesised RDO is unlikely to be the major problem, in view of the tyrosinase correction results. A good RDO quality (e.g., correct synthesis length and purity) is an obvious prerequisite, but poor RDO quality cannot entirely explain the lack of success experienced by others and us. It may be that the choice of keratinocytes as the study system is not optimal. Variation among cell types and a lower responsiveness of keratinocytes with respect to RDO-mediated sequence changes have been described (Santana et al., 1998). However, this does not explain the failure to be complete, as an ‘all-or-nothing’ principle in this is unlikely. Our ongoing experiments include in vitro reactions using nuclear extracts and the development of a mutated reporter gene system, enabling sensitive monitoring of correction frequencies in different cell lines and systems. However, preliminary results with this latter, sensitive system, used to study episomal correction in CHO cells, also indicate complete failure of the RDO technology. We believe that the persistent failure to implement the RDO technology is noteworthy. The complete lack of success hampers further studies and frustrates the usage of this theoretically tempting method. We would like to stress that, despite our disappointing experiences, we do not denounce the RDO technology as being invalid or objectionable. However, it may be of general concern, that a broad application of this technique is still to be awaited, despite the number and the extent of positive reports, especially of some in vivo studies (Bartlett et al., 2000; Kren et 75 Chapter 5 al., 1999; Rando et al., 2000). An international collaboration with free exchange of results, cell lines, and RDOs, may not only speed up the elucidation of the still unknown mechanism behind RDO-mediated sequence change, but also prove (or disapprove) its applicability. Such a call for a ‘chimeraplasty consortium’ of course includes an appeal to ‘the happy few’ who have positive experiences with this technology to participate. References Alexeev, V., Igoucheva, O., Domashenko, A., Cotsarelis, G., & Yoon, K. (2000) Localized in vivo genotypic and phenotypic correction of the albino mutation in skin by RNA-DNA oligonucleotide. Nat.Biotechnol. 18, 43. Alexeev, V. & Yoon, K. (1998) Stable and inheritable changes in genotype and phenotype of albino melanocytes induced by an RNA-DNA oligonucleotide. Nat.Biotechnol. 16, 1343. Bartlett, R.J., Stockinger, S., Denis, M.M., Bartlett, W.T., Inverardi, L., Le, T.T., Man, t.N., Morris, G.E., Bogan, D.J., Metcalf-Bogan, J., & Kornegay, J.N. (2000) In vivo targeted repair of a point mutation in the canine dystrophin gene by a chimeric RNA/DNA oligonucleotide. Nat.Biotechnol. 18, 615. Beetham, P.R., Kipp, P.B., Sawycky, X.L., Arntzen, C.J., & May, G.D. (1999) A tool for functional plant genomics: chimeric RNA/DNA oligonucleotides cause in vivo gene-specific mutations. Proc.Natl.Acad.Sci. USA 96, 8774. Cole, S.A., Gamper, H., Holloman, W.K., Munoz, M., Cheng, N., & Kmiec, E.B. (1999) Targeted gene repair directed by the chimeric RNA/DNA oligonucleotide in a mammalian cell-free extract. Nucleic.Acids.Res. 27, 1323. Cole, S.A., Yoon, K., Xiang, Y., Byrne, B.C., Rice, M.C., Gryn, J., Holloman, W.K., & Kmiec, E.B. (1996) Correction of the mutation responsible for sickle cell anemia by an RNA-DNA oligonucleotide. Science 273, 1386. Gamper, H.B., Cole, S.A., Metz, R., Parekh, H., Kumar, R., & Kmiec, E.B. (2000) A plausible mechanism for gene correction by chimeric oligonucleotides. Biochemistry 39, 5808. Igoucheva, O., Peritz, A.E., Levy, D., & Yoon, K. (1999) A sequence-specific gene correction by an RNA-DNA oligonucleotide in mammalian cells characterized by transfection and nuclear extract using a LacZ shuttle system. Gene Ther. 6, 1960. 76 Failures in gene repair Kren, B.T., Bandyopadhyay, P., & Steer, C.J. (1998) In vivo site-directed mutagenesis of the factor IX gene by chimeric RNA/DNA oligonucleotides. Nat.Med. 4, 285. Kren, B.T., Cole, S.A., Kmiec, E.B., & Steer, C.J. (1997) Targeted nucleotide exchange in the alkaline phosphatase gene of HuH-7 cells mediated by a chimeric RNA/DNA oligonucleotide. Hepatology 25, 1462. Kren, B.T., Parashar, B., Bandyopadhyay, P., Chowdhury, N.R., Chowdhury, J.R., & Steer, C.J. (1999) Correction of the UDP-glucuronosyltransferase gene defect in the gunn rat model of crigler-najjar syndrome type I with a chimeric oligonucleotide. Proc.Natl.Acad.Sci. USA 96, 10349. Rando, T.A., Disatnik, M.H., & Zhou, L.Z. (2000) Rescue of dystrophin expression in mdx mouse muscle by RNA/DNA oligonucleotides. Proc.Natl.Acad.Sci. USA 97, 5363. Santana, E., Peritz, A.E., Iyer, S., Uitto, J., & Yoon, K. (1998) Different frequency of gene targeting events by the RNA-DNA oligonucleotide among epithelial cells. J.Invest.Dermatol. 111, 1172. Yoon, K., Cole-Strauss, A., & Kmiec, E.B. (1996) Targeted gene correction of episomal DNA in mammalian cells mediated by a chimeric RNA.DNA oligonucleotide. Proc.Natl.Acad.Sci. USA 93, 2071. Zhu, T., Peterson, D.J., Tagliani, L., St, C.G., Baszczynski, C.L., & Bowen, B. (1999) Targeted manipulation of maize genes in vivo using chimeric RNA/DNA oligonucleotides. Proc.Natl.Acad.Sci. USA 96, 8768. 77 78