Download 2nd problem set

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project

Document related concepts

Cancer epigenetics wikipedia , lookup

Nucleosome wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Genome (book) wikipedia , lookup

DNA virus wikipedia , lookup

DNA polymerase wikipedia , lookup

Mutation wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

DNA vaccination wikipedia , lookup

Point mutation wikipedia , lookup

DNA barcoding wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

SNP genotyping wikipedia , lookup

Oncogenomics wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Genetic engineering wikipedia , lookup

Transposable element wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Primary transcript wikipedia , lookup

RNA-Seq wikipedia , lookup

Gene wikipedia , lookup

Genealogical DNA test wikipedia , lookup

DNA supercoil wikipedia , lookup

Molecular cloning wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Replisome wikipedia , lookup

NUMT wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Microevolution wikipedia , lookup

Epigenomics wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

DNA sequencing wikipedia , lookup

Minimal genome wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Designer baby wikipedia , lookup

Pathogenomics wikipedia , lookup

Microsatellite wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Deoxyribozyme wikipedia , lookup

History of genetic engineering wikipedia , lookup

Non-coding DNA wikipedia , lookup

Human genome wikipedia , lookup

Metagenomics wikipedia , lookup

Genome evolution wikipedia , lookup

Helitron (biology) wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Whole genome sequencing wikipedia , lookup

Genome editing wikipedia , lookup

Human Genome Project wikipedia , lookup

Genomic library wikipedia , lookup

Genomics wikipedia , lookup

Transcript
Genome 261
Spring 2007
Problem Set 2
(Remember: we will not collect these – the problem sets are for your own study for the
exams.)
DNA SEQUENCING AND THE HUMAN GENOME:
5’ ATCCGATGCCTTTGCAATAATTGTTAAACAATGCGTGGCCCCTTCATTTGAACCGAT 3’
3’ TAGGCTACGGAAACGTTATTAACAATTTGTTACGCACCGGGGAAGTAAACTTGGCTA 5’
1. Imagine you are sequencing the DNA molecule shown above. Assume the primer
5’ GATGCCT 3’ is used to initiate DNA synthesis. You have a tube containing
template, primer, millions of ACGT nucleotides and millions of dideoxyC nucleotides.
(p. 387-393 of your textbook has a good review if you are having trouble)
a) How many different lengths of DNA strands will be represented in your tube?
(Assume that there are millions of each of them because you ran the replication reaction
for a long time).
b) Predict the lengths (in nucleotides) of DNA strands you would find in this tube.
2. Read the sequencing gel below and write the DNA sequence in the blank.
A
C
G
T
5’ ______________________ 3’
3. Read the real sequencing gel on page 393 of your textbook (fig. 23.12) and write the
first 25 nucleotides below:
5’
3’
4. What is the primary difference chemically between traditional DNA sequencing and
modern, automated sequencing?
Genome 261
Spring 2007
Problem Set 2
5. Which of the following statements are true about genome sequencing?
a) After a genome is sequenced, you know exactly how many genes it contains.
b) Genome sequencing requires the artificial synthesis of DNA (synthesis
outside of a cell).
c) The sequence of a genome tells you the exact sequence of nucleotides for all
members of that species.
d) Comparing the genomes of two organisms can give you an idea of how
related they are.
6. Definitions:
a) ______________ : a sequence that immediately precedes a gene and indicates the start
of transcription.
b) ______________ : a protein that synthesizes a new strand of DNA.
c) ______________: a molecule which can terminate a growing DNA strand.
7. Which one of the following molecules is NOT found in a living cell:
8. If you have an unknown DNA double stranded molecule and you sequence one of
the strands, do you have to sequence the other strand? Why or why not?
DIFFERENCES IN THE HUMAN GENOME:
1. When geneticists are comparing the human genome to other species’ genomes, what
kinds of differences might they be looking for that make us uniquely human?
2. Describe at least two ways that being able to rapidly and cheaply sequence an
individual’s entire genome may be useful to that person.
3. Describe at least two ways that being able to rapidly and cheaply sequence an
individual’s entire genome may be detrimental to that person.
Genome 261
Spring 2007
Problem Set 2
REPRODUCTIVE TECHNOLOGIES:
1. For what reason(s) might someone choose to have their sperm sorted (for X or Y
chromosomes) before fertilization?
2. How does the process of preimplantation genetic diagnosis (PGD) work?
3. For what reason(s) might a couple have to use PGD instead of sperm sorting? (i.e.
What are the limitations of sperm sorting?)
CLONING:
1. What is the procedure to create a clone of a mammal using an adult somatic cell as a
donor?
2. List three concerns people have with respect to human reproductive cloning.
3. List two potential reasons why someone might want to have human reproductive
cloning done.