Download Common DNA sequences with potential for detection of genetically

Journal of Applied Microbiology 1998, 84, 969–980
Common DNA sequences with potential for detection of
genetically manipulated organisms in food
C.A. MacCormick, H.G. Griffin, H.M. Underwood and M.J. Gasson
Institute of Food Research, Norwich Research Park, Colney, Norwich, UK
6363/08/97: received 8 August 1997, revised 10 October 1997 and accepted 13 October 1997
Foods produced by
genetic engineering technology are now appearing on the market and many more are likely
to emerge in the future. The safety aspects, regulation, and labelling of these foods are still
contentious issues in most countries and recent surveys highlight consumer concerns about
the safety and labelling of genetically modified food. In most countries it is necessary to have
approval for the use of genetically manipulated organisms (GMOs) in the production of food.
In order to police regulations, a technology to detect such foods is desirable. In addition, a
requirement to label approved genetically modified food would necessitate a monitoring
system. One solution is to ‘tag’ approved GMOs with some form of biological or genetic
marker, permitting the surveillance of foods for the presence of approved products of genetic
engineering. While non-approved GMOs would not be detected by such a surveillance, they
might be detected by a screen for DNA sequences common to all or most GMOs. This
review focuses on the potential of using common DNA sequences as detection probes for
GMOs. The identification of vector sequences, plant transcription terminators, and marker
genes by PCR and hybridization techniques is discussed.
C .A . M a cC OR M IC K, H .G . G R IF FI N , H .M . UN DE R WO OD A ND M. J . G AS S ON . 1998.
INTRODUCTION
A wide range of genetically modified foods (GMFs) are beginning to appear in the market. These include : delayed ripening
tomatoes, herbicide-resistant soyabean plants and insectresistant maize (Ahl Goy and Duesing 1995 ; Christou 1996).
The safety, regulation, and labelling of these foods are still
contentious issues in most countries (Kok et al. 1994 ; LloydEvans 1994 ; Hallman 1996). Recent surveys (e.g. see Hallman
1996), as well as highlighting consumer concerns, also emphasize consumer preference for labelling of GMFs. To use
genetically manipulated organisms (GMOs) for food
production, approval must be sought from the regulatory
authorities. In order to police such regulations and to monitor
the labelling of approved foods, it is desirable to have a
method of detecting GMOs in food. It is possible that
approved GMOs could be identified by means of a biological
or genetic ‘tag’ permitting the surveillance of food for the
products of approved genetic technology. However, a means
might still be required to screen for unlicensed GMOs in
foods. Such a test would be required if there was a likelihood
Correspondence to: Caroline MacCormick, Institute of Food Research, Norwich
Research Park, Colney, Norwich NR4 7UA, UK (e-mail:
[email protected]).
© 1998 The Society for Applied Microbiology
of a health risk from non-approved GMFs, and also to ensure
that all GMOs used in food production are subjected to safety
assessment and regulatory procedures. A generic test for
the detection of recombinant DNA might provide a useful
screening procedure for unlicensed and/or undeclared
GMOs in food.
Trends in genetic engineering have a direct bearing on the
potential to detect the presence of recombinant DNA. If
heterologous DNA is present then this should be detectable
by gene probe or PCR techniques. Where a GMO involves
the addition of a known new gene then this is the obvious
target. Because there is a history of vector development it is
possible in some instances to design a detection method based
on the detection of DNA sequences used to construct the
GMO. These might be plasmid vector sequences, commonly
used polylinkers, selectable markers, promoters, or terminators. Such sequences are often unknown, which makes it
impossible to design detection systems without first obtaining
the sequence information. This review discusses potential
target sequences for a generic test of recombinant DNA and
comments on the practical establishment of a methodology
for the best option(s). Current gene cloning strategies will be
evaluated with a view to the best options for this generic test
strategy, based on known sequence information, and to
970 C .A . M A CC OR M IC K E T AL .
demonstrate that within its limitations it could provide a
means for the detection of recombinant DNA. Particular
emphasis will be placed on identifying those organisms of
greatest risk. This includes GMOs containing antibiotic
resistance markers, GMOs containing functional heterologous genes and GMOs containing other heterologous
DNA, such as vector sequences, which may affect the stability
of the organism.
PLANTS
Strategies to genetically manipulate plants
The methods used to introduce foreign DNA into a plant
cell include microinjection, bombardment using particle gun,
protoplast transformation, and the Agrobacterium Ti plasmid.
These methods are relatively inefficient and a selectable
marker gene is generally required to permit selection of transgenic cells in the presence of an antibiotic or herbicide. There
is a limited number of such marker (antibiotic and herbicide
resistance) genes that can be used for this purpose (Table 1).
Herbicide resistance genes are becoming increasingly popular
as selection markers in plant genetics. They are introduced
into plants either as naturally occurring resistance markers or
as modified targets of herbicide action (Kok et al. 1994). In
addition, screenable markers (reporter genes) may be intro-
duced into plants for identification purposes, tagging foreign
genes in subsequent plant generations, or monitoring the
regulation of foreign gene expression. These markers tend to
be developed from bacterial genes coding for easily assayed
enzymes (Draper and Scott 1991 ; Flavell et al. 1992 ; Kok et
al. 1994).
The Ti plasmid from Agrobacterium tumefaciens is a natural
plant transformation vehicle (Draper and Scott 1991). Most
Ti plasmids have four regions in common : origin of replication, virulence region, conjugation region and oncogenicity
region (T-DNA). The sequences flanking T-DNA have been
found to be absolutely required for integration of foreign
DNA into the plant genome (Chiurazzi and Signer 1994).
These borders are present on all T-DNA vectors and enable
random transfer of foreign DNA to the plant genome.
A promoter and a terminator are required to express genes
in plant cells. A large number of promoters can be used
including the TR1? promoter, the ocs promoter, and the nos
promoter from Agrobacterium ; the cauliflower mosaic virus
35S promoter (Jones et al. 1992) ; and many promoters of
plant origin such as the tissue-specific maize PEPC promoter
and the maize pollen-specific promoter (Koziel et al. 1993).
In contrast, there are currently only three well-characterized
terminators in widespread use. These are the Agrobacterium
nopaline synthase terminator, the Agrobacterium octopine
synthase terminator, and the cauliflower mosaic virus ter-
Table 1 Selectable marker and reporter genes used in plant genetic manipulation*
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Gene
Product
Action
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
Antibiotic resistance genes
aphA2/nptII
Aminoglycoside-3? phosphotransferase II
Permits growth in kanamycin, neomycin and geneticin (G418)
hpt
Aminoglycoside-3? phosphotransferase IV
Permits growth in hygromycin B
dhfr
Dihydrofolate reductase
Permits growth in methotrexate and trimethoprim
ble
Uncharacterized
Permits growth in bleomycin
Herbicide resistance genes
bar/pat
Phosphinotricin acetyl transferase
mutant aroA
5-enol-pyruvilshikimate-3-phosphate synthase
mutant als
Acetolactate synthase
mutant psbA
QB protein
bxn
Nitrilase (bacterial)
tfdA
2,4-dichlorophenoxyacetate monooxygenase
Resistance to glufosinate and bialaphos
Resistance to glyphosate
Resistance to sulphonureas (chlorsulphuron) and imidazolinones
Resistance to atrizine
Resistance to bromoxynil
Resistance to 2,4-dichlorophenoxy (2,4-D) acetic acid
Screenable marker genes
gus
b-glucuronidase
Detection by chromogenic or flurogenic substrates
lux/luc
Luciferase
Detected by bioluminescence assays
c1b/c1r
Anthocyanin
Produces red pigment
cat
Chloramphenicol acetyl transferase
Detected by enzymatic assay
lacZ
b-galactosidase
Detected by enzymatic assay
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
* See Draper and Scott (1991) ; Flavell et al. (1992) ; Kok et al. (1994) ; and McElroy and Brettel (1994).
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
D ET EC T IN G G E NE TI C AL LY M AN IP U LA TE D OR GA N IS MS I N F OO D 971
minator (Jones et al. 1992). In addition to being required for
heterologous or trait genes, terminators are also used to stop
the transcription of genes encoding selectable markers on
vectors (e.g. antibiotic or herbicide resistance genes).
It is desirable to change certain traits in plants in order to
improve the species. Traits that are currently being targeted,
and that are of economic importance, include tolerance to
disease, tolerance to environmental stress, yield of product,
and quality of product. Attention has focused on producing
strains of plants resistant to herbicide, tolerant to salinity,
frost, or drought, and resistant to insects and viruses (Grierson 1991 ; Day 1996). Development of a product (e.g. fruit)
with a longer shelf life is a prime example of an improvement
to a plant product. To achieve the desired trait it is usually
necessary to produce a transgenic plant that is expressing a
heterologous gene or one in which an existing gene has been
mutated. Such genes are referred to here as ‘trait genes’.
Strategies to detect genetically manipulated plants
Hybridization probes or PCR primers can be designed within
the nptII, hpt, dhfr and ble marker genes (Table 1) and used to
detect the presence of this DNA. The commercially available
FlavrSavrTM tomato contains an nptII marker gene which
can be detected in this way. However, antibiotic resistance
markers used in laboratory construction of plant expression
systems may be eliminated from genetically modified plants
prior to their application in the field. Herbicide resistance
markers (Table 1) are less likely than antibiotic markers to be
removed from plant cells prior to release into the field since
they can be exploited by the plant grower. The need for
removal of these genes will depend on the requirements
of regulatory agencies (and on public debate). Probes can
therefore be designed for the identification of these markers.
Screenable markers such as b-glucuronidase, bacterial and
insect luciferases, the anthocyanin reporter system, chloramphenicol acetyl transferase, and b-galactosidase (Table 1)
are used in plants. Hybridization and PCR probes can be
designed for the detection of these genes. T-DNA borders,
however, are very short DNA sequences and hybridization
probes are unlikely to be useful. Instead, overlapping PCR
primers could be used in nested PCR reactions as a means of
identification.
Specific trait genes (or changes to trait genes) could be
detected by probing and/or PCR. A ‘cocktail’ of probes or a
multiplex PCR approach (Fig. 1) might be employed to detect
a number of trait genes in a single experiment. The multiplex
PCR system may have some limiting factors including nonspecific annealing of primers and primer–dimer formations.
These may be avoided or reduced by limiting each multiplex
PCR to no more than four reactions at a time and careful
designing of primers to eliminate primer–dimer formation
Fig. 1 Protocol for the detection of genetically manipulated
organisms by multiplex PCR
and enable all primers to work optimally under the same
reaction conditions.
It is unlikely that a detection system based solely on the
identification of promoters would be useful for the detection
of genetically engineered plants due to the number of potential sequences that could be used. In addition, it is possible
to construct synthetic promoters for this purpose. However,
a probe or PCR approach to detect the three terminator DNA
sequences may be useful. The possibility of new terminators
being characterized and used in the future, however, must be
considered.
The most common polylinker employed in the construction of transgenic plants is that of the Escherichia coli
vector pUC19 (Draper and Scott 1991 ; Jones et al. 1992).
The ‘Bluescript’ polylinker is also used (Jones et al. 1992)
and other synthetic polylinkers have been constructed (Malik
and Wahab 1993). Hybridization probes could be designed
containing all or sections of these polylinker regions. The
advantage of this strategy is that it is applicable to most areas
of plant recombinant DNA technology.
Some examples of specific sequences with potential to
detect genetically manipulated plants are presented in Table
2. They include : the three plant terminators, the antibiotic
resistance gene, nptII, and the herbicide resistance gene, bar.
In each case two primer sequences have been designed with
known DNA. In some instances, genes such as bar are
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
972 C .A . M A CC OR M IC K E T AL .
Table 2 Primer sequences with potential to detect genetically engineered plants
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Target DNA
Primers A and B
Potential PCR/probe size
Reference
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
nos terminator
AGAAGGAGTGCGTCGAAGCA
178 bp
Depicker et al. (1982)
AATCATAAAAACCCATCTCA
ocs terminator
ATCAAATCTTCCAGCTTTAA
CAATCAGTAAATTGAACGGA
185 bp
De Greve et al. (1983)
camv terminator
CGCAAATCACCAGTCTCTCT
ACTGGATTTTGGTTTTAGGA
201 bp
Toepfer et al. (1987)
nptII gene
GGATTGCACGCAGGTTCTCC
AACTCGTCAAGAAGGCGATA
772 bp
Beck et al. (1982)
bar gene
GCCGACATCCGCCGTGCCAC
479 bp
Thompson et al. (1987)
GTCCAGCTGCCAGAAACCCA
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
nos, nopaline synthase ; ocs, octopine synthase ; camv, cauliflower mosaic virus ; nptII, neomycin phosphotransferase II ; bar, bialophos
resistance.
expected to be present intact in the modified plant and the
PCR primers can be used directly on the genetically modified
plant. In most other instances the presence of completely
intact genes or entire terminator regions cannot be guaranteed. In these cases the two primers are applied to known
DNA to produce a PCR product of particular size (shown
in Table 2). The PCR product is then used as a southern
hybridization probe on plant DNA, whereby a positive result
will indicate the presence of genetically modified plant DNA.
This PCR/hybridization approach is illustrated in Fig. 2.
LACTIC ACID BACTERIA
The vast majority of bacteria used in the food and dairy
industries belong to the group known as the lactic acid bacteria (LAB). Lactic acid bacteria are of major economic
importance as they occupy a key position in the manufacture
of fermented foods from a variety of raw products including
vegetables, cereals, meat, and milk. In general, genetic
manipulation of LAB is achieved either by the inactivation
of a gene or by the expression/overexpression of a gene
(Gasson and de Vos 1994). Such manipulation may affect a
biochemical pathway resulting in different end products or
altered yields of end products. This in turn affects the taste,
texture, yield, or quality of the fermented food.
Strategies to genetically manipulate LAB
Interruption of a chromosomal gene can be achieved by single
cross-over homologous recombination (I’Anson et al. 1995).
Fig. 2 Protocol for the detection of genetically manipulated
organisms (GMO) by hybridization
Selection of recombinants by antibiotic resistance is usually
required. Transposon mutagenesis can also be used to disrupt
genes in LAB. Transposons such as Tn916 and Tn919
(Gawron-Burke and Clewell 1982 ; Clewell and Gawron-
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
D ET EC T IN G G E NE TI C AL LY M AN IP U LA TE D OR GA N IS MS I N F OO D 973
Burke 1986) encode antibiotic resistance and are not normally
found in LAB used in food production.
Deletion of a chromosomal gene is usually achieved by
double cross-over homologous recombination. In this
method, the gene is cleanly removed from the chromosome
and normally no foreign DNA is left behind in the chromosome (MacCormick et al. 1995). Alternatively, the fragment of DNA removed from the chromosome can be replaced
with another fragment (Leenhouts et al. 1991). Sometimes a
strategy is employed in which the deleted gene is replaced
with a marker gene, for example an antibiotic resistance gene
or a colour marker such as the b-galactosidase gene (Payne et
al. 1996).
A foreign gene in LAB can be expressed on a plasmid
(MacCormick et al. 1995) or in the chromosome (Van de
Guchte et al. 1992 ; Wells et al. 1993 ; Payne et al. 1996). To
insert a foreign DNA fragment into the chromosome single
or double cross-over recombination is normally used (Van de
Guchte et al. 1992 ; Benson et al. 1996 ; Maguin et al. 1996).
Integration vectors based on transposons are rare in LAB,
primarily due to the need for efficient conjugal transfer.
Vectors based on Tn917 have been developed for Lactococcus
lactis MG1614, but these appear to be strain-specific and have
low transposition frequencies (Israelsen and Hansen 1993).
The plasmid-based expression of genes in LAB is not only
easier to achieve than chromosomal expression, but also has
the added advantage of potentially higher levels of expression
due to higher gene copy numbers (Van de Guchte et al. 1992 ;
Wells et al. 1993 ; Benson et al. 1996). Overexpression of a
homologous gene is also most readily achieved using a plasmid-based system (Van de Guchte et al. 1992 ; MacCormick
et al. 1996 ; Benson et al. 1996). Antisense technology, which
is used to inhibit the expression of a gene, requires the
transcription of a DNA fragment and is normally achieved
with a plasmid-based system. As food-grade plasmid
expression systems for LAB (i.e. those containing DNA of
LAB origin only) are still at the early stages of development
(MacCormick et al. 1996 ; Platteeuw et al. 1996), it is likely
that unlicensed GMOs will used plasmids containing foreign
DNA. There are several expression plasmid systems available
for LAB and in particular L. lactis. The original systems are
based on broad host range plasmids and these include the
pIL vectors based on pAMb1 from Enterococcus faecalis
(Simon and Chopin 1988). The more recent expression systems are based on small, cryptic lactococcal plasmids and
these include pGKV2, based on pWV01 and pCK1, based
on pSH71 (Gasson and de Vos 1994). All of these vector
systems rely on heterologous antibiotic resistance markers for
selection.
Strategies to detect genetically manipulated LAB
Single cross-over mutants can be detected by screening for
antibiotic resistance genes, promoters, terminators and poly-
linkers by PCR or by hybridization techniques. Detection of
double cross-over mutants is more difficult and may require
a knowledge of the site of insertion or of the sequence being
inserted. If the target gene was known, then genetic manipulation could be detected by PCR or hybridization. Similarly,
if the site is known, disruption of the chromosome in that
region could be detected. However, due to the large number
of potential target genes and insertion sites this is probably
not a realistic strategy for detecting GMOs with unknown
modifications.
Detection of a high proportion of GMOs might be achieved
by screening for the presence of the DNA sequences used in
the construction strategy. Such sequences include : vector
sequences, polylinkers, antibiotic resistance and marker
genes, origin of plasmid replication, b-galactosidase gene, and
universal primer sites. Most markers used in LAB originate
from other bacterial species (Table 3). A number of GMOs
will contain markers, or remnants of markers, that were used
in the construction of the genetically manipulated strain.
These may be either chromosomally or plasmid located. A
cocktail or probes designed from these markers could be used
in a hybridization experiment to detect potential unlicensed
genetically manipulated LAB in food. Similarly, a battery of
PCR primers could be employed to screen for these markers
using a PCR-based approach. A series of nested-PCRs could
be implemented to reduce the possibility of false positive
results. A similar approach could be used to detect polylinkers
or primer sites. the most common polylinker in use in most
molecular biology laboratories is the one derived from pUC19
(Sambrook et al. 1989). However, 20–30 other polylinkers are
also in common use. These include the polylinkers of other
pUC plasmids, pGEM, pBluescript, pNEB 193, pMAL,
pET, pSP, and pKK vectors (Pouwels et al. 1985). Many
plasmids used in generating genetically engineered strains
contain binding sites for the universal forward and reverse
primers (Sambrook et al. 1989). In some cases these sites
might be retained in the final GMO strain.
Detection of a homologous chromosomal gene on a plasmid
could be achieved by performing a Southern hybridization of
undigested total DNA and probing with labelled chromosomal
DNA. As the plasmid DNA migrates further than the chromosome two bands or more would be apparent compared with
a single (chromosomal) band in the wild-type strain.
Some examples of specific sequences with potential to detect
genetically manipulated LAB are presented in Table 4. These
include the three most common antibiotic markers, the
reporter gene, lacZ and the universal and reverse primer binding sites. In each case primers have been designed from known
DNA sequences. For the four marker genes primers A and B
will produce a band of particular size (shown in Table 4). The
resulting PCR products can be used as Southern hybridization
probes for the detection of genetically modified LAB. The
probes from all four reactions could be added together in one
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
974 C .A . M A CC OR M IC K E T AL .
Table 3 Antibiotic resistance and marker genes used in LAB genetic manipulation
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Gene
Product/phenotype
Origin
Reference
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
cat
Chloramphenicol acetyltransferase
Staphylococcus aureus plasmid pC194
Horinouchi and Weisblum (1982a)
MLS genes
Erythromycin resistance
Staphylococcus aureus plasmid pE194
Horinouchi and Weisblum (1982b)
MLS genes
Erythromycin resistance
Enterococcus faecalis plasmid pAMb1
Brehm et al. (1987)
tet
Tetracycline resistance
Streptococcus pneumoniae
Van de Guchte et al. (1992)
gus
b-glucuronidase
Escherichia coli
Platteeuw et al. (1995)
lacZ
b-galactosidase
Escherichia coli
Beckwith (1987)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
Table 4 Primer sequences with potential to detect genetically engineered lactic acid bacteria
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Target DNA
Primers A and B
Potential PCR/probe size
Reference
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
MLS gene
AAGTTAAGGGATGCAGTTT
691 bp
Horinouchi and Weisblum (1982b)
AAGGAGGAAAAAATATGCGC
cat gene
TGGATATACCACCGTTGATA
CGCAGTACTGTTGTAATTCA
619 bp
Alton and Vapnek (1979)
tet gene
ATCCGTATTAGACGGAGCAG
CGACAGAAGCCCAGAAAGGA
1070 bp
Widdowson et al. (1996)
lacZ gene
GTTACCCACTTAATCGCCT
ATCGATAATTTCACCGCCGA
779 bp
Kalnins et al. (1983)
Universal and
CCCAGTCACGACGTTGTAAAACG –
Sambrook et al. (1989)
reverse primers
AGCGGATAACAATTTCACACAGG
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
MLS, macrolide, lincosamide and streptogramin type B resistance ; cat, chloramphenicol acetyl transferase ; tet, tetracycline ; lacZ,
encoding b-galactosidase.
multiplex hybridization reaction. This approach will detect
intact markers and also marker remnants. Similarly a multiplex
PCR approach can be used to detect intact marker genes. In
this instance primers A and B for all four genes are added
together in a single PCR reaction directly on the LAB or LABcontaining food. Any positive result can then be analysed
further. The multiplex PCR approach is illustrated in Fig. 1.
The use of universal and reverse primers for detection is more
limited due to the small amount of foreign DNA present and
a hybridization approach cannot be used. These primers can
be used in PCRs together or separately with known integration
target sites in LAB. A positive PCR result will indicate the
presence of vector remnants in the LAB.
of fermented foods such as soya sauce. Saccharomyces cerevisiae is by far the most prevalent species of yeast used in
food production. In recent years much research has been
conducted into the genetic manipulation of S. cerevisiae in
order to enhance indigenous characteristics, such as ethanol
tolerance, and to obtain expression of foreign genes and the
secretion of foreign proteins, some of which are useful to the
food industry (Sturley and Young 1986 ; Romanos et al. 1992 ;
Tuite 1992). Strategies for the genetic manipulation of S.
cerevisiae have been reviewed (Kingsman and Kingsman
1988 ; Tuite 1992). They include gene disruption, gene
deletion, gene replacement and chromosome engineering.
YEAST
Strategies to genetically manipulate yeasts
Yeast is an important micro-organism in the food industry
and has applications in brewing, baking and in the production
Cloned DNA is transformed into yeast by spheroplast uptake,
lithium acetate/PEG transformation, or electroporation. Plas-
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
D ET EC T IN G G E NE TI C AL LY M AN IP U LA TE D OR GA N IS MS I N F OO D 975
mid-based (episomal or integrating) vectors are used to introduce cloned DNA into S. cerevisiae. Episomal vectors are
autonomously replicating plasmids, the most basic of which is
the ARS plasmid. These plasmids are based on sequences from
the yeast genome. They contain a yeast origin of replication, a
yeast selection marker, an E. coli origin of replication and an E.
coli selection marker. A second class of episomal vectors are 2 m
plasmids. These are E. coli yeast shuttle vectors based on the
naturally occurring 2 m yeast plasmids (Romanos et al. 1992).
Yeast integrative plasmids (YIp) contain yeast chromosomal
DNA, a yeast selection marker, a bacterial origin or replication
and a bacterial selection marker (Romanos et al. 1992).
Strategies to detect genetically manipulated yeasts
Particular yeast vector components can be targeted for the
identification of genetically engineered yeast. These components include selection markers, promoters, terminators,
multiple cloning sites, and Ty elements.
Differentiation between transformed and untransformed
yeast cells requires that yeast transformants have a selectable
marker (Table 5). Auxotrophic selection is the most common
form of selection in laboratory strains of S. cerevisiae and
involves the isolation of auxotrophic mutant strains followed
by complementation of the mutation with the wild-type gene.
Dominant selection markers are more useful as they increase
the host range to include prototrophic and industrial strains
of S. cerevisiae, and can be used for selection in rich medium.
Probes and primers to resistance genes can be designed for
identifying a range of dominant selection markers. The main
limitation to this strategy is that selection markers can be
removed from the yeast genome (Reiser et al. 1990). Although
the removal of these antibiotic resistance markers may reduce
the risk of such modified yeasts it may still be that remnants
of antibiotic genes or other heterologous DNA of perceived
risk are detectable in these strains.
There is a large variety of native and engineered promoters
available for efficient transcription of foreign genes in yeast
(Buckholz and Gleeson 1991 ; Gellissen et al. 1992 ; Romanos
et al. 1992 ; Good and Engelke 1994). It is unlikely that native
yeast promoters could be used to distinguish between GMOs
and non-GMOs, as the promoter will exist naturally in most
yeast strains. However, hybrid or engineered promoters are
sometimes employed in yeast expression systems. In some
instances mammalian promoter elements have been used to
produce novel yeast promoters (Romanos et al. 1992). In the
case of hybrid, engineered, or manipulated promoters it
would be possible to detect GMOs using PCR or hybridization, or a combination of both. The use of overlapping
primers in nested PCR may be employed here to reduce any
background caused by the detection of constitutive
promoters. Foreign promoters not recognized by yeast RNA
polymerase can be used in yeast provided the appropriate
RNA polymerase is co-expressed. An example of such a
system is the bacteriophage T7 RNA polymerase system, and
this polymerase has been successfully expressed in yeast cells
(Romanos et al. 1992). Foreign expression systems such as
this could be detected.
Yeast transcriptional terminators are usually present in
expression systems for efficient mRNA 3? end formation.
Terminators of prokaryotic or higher eukaryotic genes are
not normally active in yeast. Efficient termination is required
Table 5 Selectable markers used in yeast genetic manipulation
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Gene
Action
Reference
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
Auxotrophic selection markers
LEU2/leu-d
Complements strains deficient in leucine biosynthesis
Beggs (1978)
TRP1
Complements strains deficient in tryptophan biosynthesis
Tschumper and Carbon (1980)
URA3
Complements strains deficient in uracil biosynthesis
Struhl et al. (1979)
HIS3
Complements strains deficient in histidine biosynthesis
Struhl et al. (1979)
LYS2
Complements strains deficient in lysine biosynthesis
Barnes and Thorner (1986)
Dominant selection markers
G418 gene
G418 resistance
Jimenez and Davies (1980)
HPH
Hygromycin B resistance
Kaster et al. (1984)
CUP1
Copper resistance
Hottiger et al. (1995)
ble
Bleomycin resistance
Gatignol et al. (1987)
cat
Chloramphenicol resistance
Reiser et al. (1990) ; Romanos et al. (1992)
TK
Thymidine, amethopterin and sulphanilamide resistance
Reiser et al. (1990) ; Romanos et al. (1992)
dhfr
Methotrexate resistance
Resier et al. (1990) ; Romanos et al. (1992)
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
976 C .A . M A CC OR M IC K E T AL .
for maximal expression of genes in yeast. Transcriptional
termination is less well understood in yeast than in bacteria
and higher eukaryotes and for this reason terminators of yeast
origin are normally employed in genetically modified yeast.
Multiple cloning sites used in yeast vectors are derived
from the commonly used polylinkers such as pUC19 (Viera
and Messing 1982). A number of additional synthetic polylinkers have also been designed (Sambrook et al. 1989).
Hybridization probes or PCR primers may be designed containing all or sections of these polylinker regions. Several
probes can be developed with different combinations of
restriction sites. For example the pUC19 or pBluescript polylinkers can be used in part or complete as probes. The more
commonly used restriction sites such as those specific for
HindIII, PstI, BamHI SmaI, SacI and EcoRI could be used
in different combinations to form a series of probes. The
advantage of this strategy is that it is applicable to most areas
of recombinant DNA technology.
Ty-1 elements are yeast transposons present in the S.
cerevisiae genome at a copy number of 30–35. They are about
5·9 kb in length and are composed of an epsilon region
(containing TYA and TYB transposition genes) and two
flanking 340 bp direct repeat sequences called delta
sequences. Other Ty elements contain similar but different
long terminal repeats. Modified Ty elements containing a
strong, regulated promoter (e.g. GAL1) have been used in
the construction of yeast transposition vectors (Boeke et al.
1988). These vectors have the advantage of being stable, highcopy number integration vectors and can be used for highlevel expression of heterologous genes. The introduction of
a heterologous gene will be done in such a way as not to affect
the transposition function of the Ty element and therefore
TYA and TYB will remain intact. Primers can be designed,
for example, within TYB (see Table 6) and the PCR product
used as a hybridization probe. Modified Ty elements will
produce larger band sizes than unmodified elements, in
hybridization experiments, due to the presence of the heterologous gene.
Some specific sequences with potential to detect genetically
manipulated yeast are presented in Table 6. They include ;
the dominant selection markers, HPH and CUPI, T7 RNA
polymerase, pUC19 polylinker and the Ty-1 element. In each
case two primers have been designed within a known DNA
sequence and when used together in a PCR reaction, on
known DNA, will produce a band of particular size. The
subsequent PCR product can then be used as a Southern
hybridization probe for the detection of genetically modified
yeasts. This hybridization approach is applicable to all of the
examples in Table 6 and is illustrated in Fig. 2. In all cases
except Ty-1, a positive result will indicate the presence of
modified DNA. In the case of Ty-1 all results will be positive
and will have to be compared with that of a known unmodified
yeast DNA in order to assess the presence of additional DNA.
DISCUSSION
The diverse nature of the various organisms included in this
study (plants, bacteria, and yeast) does not facilitate the design
of any single probe or primer system that could be used to
distinguish between a GMO and a non-GMO. Each type
of organism (plant, bacterium, and yeast) has characteristic
requirements for particular expression vectors, transcriptional promoters and terminators, marker and selection
systems, and other genetic elements.
It may be possible to have different detection systems
aimed at detecting the different classes of GMOs. For example, a detection system for genetically engineered plant cells,
a separate system for detection of genetically engineered bacteria, and a third system to detect genetically engineered yeast
cells. In most cases the species of suspected organism in the
food under investigation would be known. For example, it is
probably only necessary to search for genetically manipulated
lactic acid bacteria in cheddar cheese ; a search for genetically
engineered plants would not be required in this case. A
specific test for genetically modified plants could be based on
detection of the three commonly used terminators. However,
such obvious targets do not exist for bacteria or yeast. A
combination of tests is more likely to be effective in the
detection of GMOs for all three genera. For example : in
plants, a test for terminators could be combined with a test
for antibiotic and herbicide resistance markers ; in bacteria, a
test for antibiotic resistance markers could be combined with
tests for screenable markers and E. coli vector remnants, and
in yeasts, tests for selection markers could be combined with
tests for T7 RNA polymerase and Ty-1 modifications.
Any detection system for GMOs would probably be based
on either nucleic acid hybridization or PCR technology, or a
mixture of the two. The hybridization strategy depends on
the use of DNA probes (either a single probe, a mixture of
probes, or a battery of individual probes) to detect specific
nucleic acid in the sample that would indicate genetic
manipulation had occurred. This strategy is the best option
for detecting large, intact genes/DNA regions of known
sequence. These include : antibiotic resistance and herbicide
resistance markers, screenable markers such as b-galactosidase and T7 RNA polymerase. The PCR approach uses
short DNA sequences (primers) to detect the presence of
specific DNA in the sample that would be indicative of genetic
manipulation. There is a remote possibility that the sequences
detected are natural, in particular if whole genes are detected.
Individual sets of primers can be used or a mixture of primers
could be employed. The PCR approach can be applied to the
types of genes mentioned for hybridization but would be best
applied to situations where the DNA inserts/alterations are
short and/or fragmented. Examples include : promoters, terminators and vector remnants such as polylinkers. Nested
PCR, which involves the use of primers, often overlapping,
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
D ET EC T IN G G E NE TI C AL LY M AN IP U LA TE D OR GA N IS MS I N F OO D 977
Table 6 Primer sequences with potential to detect genetically engineered yeast
–—–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Target DNA
Primers A and B
Potential PCR/probe size
Reference
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
HPH gene
ATGAAAAAGCCTGAACTCAC
989 bp
Gritz and Davies (1983)
GTTTCCACTATCGGCGAGTA
CUPI gene
GCGAATTAATTAACTTCCAA
TTCATTTCCCAGAGCAGCAT
179 bp
Hottiger et al. (1995)
T7 RNA polymerase
CTTGCCTAACCAGTGCTGAC
TACCACCGTCACGCTCACAG
1699 bp
Moffatt et al. (1984)
pUC19 polylinker
AAGCTTGCATGCCTGCAGGT
GAATTCGAGCTCGGTACCCG
57 bp
Sambrook et al. (1989)
Ty1
TCGTCCCAATCAATAAACCC
1030 bp
Warmington et al. (1985)
CCTAGATACAGTAAAGATA
––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
—
HPH, hygromycin B phosphotransferase ; CUPI, copper metallothionein ; Ty1, yeast transposon.
in consecutive reactions can be applied when only very short
DNA sequences are present such as in the case of T-DNA
borders, and universal/reverse primer binding sites.
Much genetic engineering involves manipulation of the
organism’s naturally occurring DNA, for example, the overexpression of a yeast gene using yeast promoters. It is not
easy to distinguish between GMOs and non-GMOs in this
case, using DNA-based detection methods, because the same
DNA is present in both GMOs and non-GMOs, albeit in a
different arrangement or copy-number. In this case, genetically manipulated plasmids could be detected by Southern
hybridization of total undigested DNA. A plasmid containing
a chromosomal gene (e.g. for overexpression purposes) would
be detected by the presence of two bands when probed with
chromosomal DNA because the plasmid would migrate differently to the chromosomal band. In the wild-type only the
chromosomal DNA would hybridize yielding only one band.
Similarly, an altered naturally-occurring plasmid could be
detected by a change in band size when using plasmid DNA
as a probe, but only if the insert is of sufficient length to be
detected. However, as these GMOs are difficult to detect and
are of lesser perceived risk than those containing heterologous
DNA they are unlikely to be included in a detection strategy.
The majority of GMOs, however, will contain a certain
amount of ‘foreign’ or synthetic DNA, even if only a small
remnant sequence was left by the manipulation process. The
source of this heterologous DNA is often E.coli, the standard
organism used in the laboratory during DNA manipulations.
For example, GMOs might contain remnants of E. coli
vectors, antibiotic resistance markers, multiple cloning sites
(polylinkers), or primer sites. One detection strategy which
could be expected to detect a small percentage of all GMOs
(plants, bacteria, and yeast) might be possible. Such a system
would have at least four stages which are illustrated in Fig.
3. First, a cocktail of probes would be used in a hybridization
experiment in an attempt to detect E. coli vector sequences.
This probe cocktail would contain DNA from all commonly
used vectors. The second stage would be a similar hybridization using probes designed from all the common antibiotic
Fig. 3 Universal protocol for the detection of genetically
manipulated organisms containing Escherichia coli DNA
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
978 C .A . M A CC OR M IC K E T AL .
selection markers. The third hybridization would utilize probes comprising all commonly used polylinkers. The fourth
stage would be PCR-based using commonly used primers,
for example the ‘universal’ and ‘reverse’ primers present on
many vectors. This detection regime would be an approach
to detect DNA not normally found in food organisms. This
strategy is useful due to its wide application but is best
used in combination with more specific tests applied to each
genera.
Another decision strategy covering all genera might be
based on heterologous promoter systems such as the bacteriophage T7 RNA polymerase system. This expression
technique utilizes the T7 RNA promoter to express the
desired gene. This expression system can be used in most
GMOs (plants, bacteria, and yeast) and DNA probes or PCR
primers designed from the T7 polymerase could be used to
detect GMOs using this system. As with the E. coli detection
system, this test is best used in combination with more specific
tests for each genus.
It is likely that particular importance will be placed on
the detection of GMOs of greatest potential risk, e.g. those
containing heterologous DNA, antibiotic resistance markers
or vector DNA. Fortuitously, these are the easiest classes of
GMOs to detect by the methods described in this review. It
is likely that generic tests would be devised to detect the
majority of these GMOs. This study has focussed on identifying initial generic test strategies for the identification of
GMOs in food. Once unlicensed GMOs have been identified,
further, more intensive genetic screening may be carried out
in their assessment.
Any system used in the detection of GMOs would need to
be constantly monitored and reviewed, modified and updated.
This is because the fields of genetics and molecular biology
advance at a rapid pace and new methods and technologies
are constantly appearing. The tools available for producing
GMOs for the food industry are being continually improved
and new methods developed. Any DNA-based detection system would need to keep up with advances in genetic technology.
ACKNOWLEDGEMENTS
This work was supported by MAFF project no. FF0201.
REFERENCES
Ahl Goy, P. and Duesing, J.H. (1995) From pots to plots : genetically
modified plants on trial. Bio/technology 13, 454–458.
Alton, N.K. and Vapnek, D. (1979) Nucleotide sequence analysis
of the chloramphenicol resistance transposon Tn9. Nature 282,
864–869.
Barnes, D.A. and Thorner, J. (1986) Genetic manipulation of the
Saccharoymces cerevisiae by use of the LYS2 gene. Molecular Cell
Biology 6, 2828–2838.
Beck, E., Ludwig, E.A., Auerswald, B. and Schaller, H. (1982)
Nucleotide sequence and exact localization of the neomycin
phosphotransferase gene from transposon Tn5. Gene 19, 327–
336.
Beckwith, J. (1987) The lactose operon. In Escherichia coli and
Salmonella typhimurium, Cellular and Molecular Biology ed.
Neidhardt, F.C. pp. 1444–1452. Washington DC : American
Society for Microbiology.
Beggs, J.D. (1978) Transformation of yeast by replicating hybrid
plasmid. Nature 275, 104–109.
Benson, K.H., Griffin, H.G. and Gasson, M.J. (1996) Expression
of a cloned ilvBN gene to increase acetolactate synthase activity
and diacetyl production in Lactococcus lactis. Applied Microbiology
45, 107–111.
Boeke, J.D., Xu, H. and Fink, G.R. (1988) A general method for
the chromosomal amplification of genes in yeast. Science 239,
280–282.
Brehm, J., Salmond, G. and Minton, N. (1987) Sequence of the
adenine methylase gene of the Streptococcus faecalis plasmid
pAMb1. Nuclear Acids Research 15, 3177.
Buckholz, R.G. and Gleeson, M.A.G. (1991) Yeast systems for the
commercial production of heterologous proteins. Bio/technology
9, 1067–1072.
Chiurazzi, M. and Signer, E.R. (1994) Termini and telomeres in TDNA transformation. Plant Molecular Biology 26, 923–934.
Christou, P. (1996) Transformation technology. Trends in Plant
Science 1, 423–431.
Clewell, D.B. and Gawron-Burke, C. (1986) Conjugative transposons and the dissemination of antibiotic resistance in streptococci. Annual Review of Microbiology 40, 635–659.
Day, P.R. (1996) Genetic modification of proteins in food. Critical
Reviews of Food Science and Nutrition 36, S49–S67.
De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montague, M. and Schell, J. (1993) Nucleotide sequence and transcript
map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene. Journal of Molecular Applied Genetics 1, 499–
511.
Depicker, A., Stachel, S., Dhaese, P., Zambryski, P. and Goodman,
H.M. (1982) Nopaline synthase : transcript mapping and DNA
sequence. Journal of Molecular Applied Genetics 1, 563–573.
Draper, J. and Scott, R. (1991) Gene transfer to plants. In Plant
Biotechnology Vol. 1 ed. Grierson, D. pp. 38–81. New York :
Blackie and Son, Chapman and Hall.
Flavell, R.B., Dart, E., Fuchs, R.L. and Fraley, R.T. (1992)
Selectable marker genes : safe for plants? Bio/technology 10, 141–
144.
Gasson, M.J. and de Vos, W.M. (1994) Genetics and Biotechnology
of Lactic Acid Bacteria. Glasgow : Blackie Academic and Professional.
Gatignol, A., Baron, M. and Tiraby, G. (1987) Phleomycin resistance encoded by the ble gene from transposon Tn 5 as a dominant
selectable marker in Saccharomyces cerevisiae. Molecular Gene
Genetics 207, 342–348.
Gawron-Burke, C. and Clewell, D.B. (1982) A transposon in
Streptococcus faecalis with fertility properties. Nature 300, 281–
284.
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
D ET EC T IN G G E NE TI C AL LY M AN IP U LA TE D OR GA N IS MS I N F OO D 979
Gellissen, G., Melber, K., Janowicz, Z.A. et al. (1992) Heterologous
protein production in yeast. Antonie van Leeuwenhoek 62, 79–
93.
Good, P.D. and Engelke, D.R. (1994) Yeast expression vectors using
RNA polymerase III promoters. Gene 151, 209–214.
Grierson, D. (1991) Plant Genetic Engineering. Glasgow: Blackie and
Son.
Gritz, L. and Davies, J. (1983) Plasmid-encoded hygromycin B
resistance : the sequence of the hygromycin B phosphotransferase
gene and its expression in Escherichia coli and Saccharomyces
cerevisiae. Gene 25, 179–188.
Hallmann, W.K. (1996) Public perceptions of biotechnology, another look. Bio/technology 14, 35–38.
Horinouchi, S. and Weisblum, B. (1982a) Nucleotide sequence
and functional map of pE194, a plasmid that specifies inducible
resistance to macrolide, lincosamide, and streptogramin type B
antibiotics. Journal of Bacteriology 150, 804–814.
Horinouchi, S. and Weisblum, B. (1982b) Nucleatide sequence
and functional map of pC194, a plasmid that specifies inducible
chloramphenicol resistance. Journal of Bacteriology 150, 815–
825.
Hottiger, T., Kuhla, J., Pohlig, G. et al. (1995) 2-mm vectors containing the Saccharomyces cerevisiae metallothionein gene as a
selectable marker : Excellent stability in complex media and highlevel expression of a recombinant protein from a CUP1-promotercontrolled expression cassette in cis. Yeast 11, 1–14.
I’Anson, K.J., Movehedi, S., Mulholland, F., Griffin, H.G. and
Gasson, M.J. (1995) A non-essential glutamyl aminopeptidase is
required for optimal growth of Lactococcus lactis MG1363 in milk.
Microbiology 141, 2873–2881.
Israelsen, H. and Hansen, E.B. (1993) Insertion of transposon Tn917
derivatives into the Lactococcus lactis subsp. lactis chromosome.
Applied Environmental Microbiology 59, 21–26.
Jimenez, A. and Davies, J. (1980) Expression of a transposable
antibiotic resistance element in Saccharomyces. Nature 27, 869–
871.
Jones, J.D.G., Shlumukov, L., Carland, F. et al. (1992) Effective
vectors for transformation, expression of heterologous genes, and
assaying transposon excision in transgenic plants. Transgenic
Research 1, 285–297.
Kalnins, A., Otto, K., Ruether, U. and Mueller-Hill, B. (1983)
Sequence of the lacZ gene of Escherichia coli. EMBO Journal 2,
593–597.
Karin, M., Najarian, R., Haslinger, A., Valenzuela, P., Welcg, J.
and Fogel, S. (1984) Primary structure and transcription of the
amplified genetic locus : The CUPI locus of yeast. Proceedings of
the National Academy of Science USA 81, 337–341.
Kaster, K.R., Burgett, S.G. and Ingolia, T.D. (1984) Hygromycin
B resistance as dominant selectable marker in yeast. Current Genetics 8, 353–358.
Kingsman, S.M. and Kingsman, A.J. (1988) Genetic Engineering :
An Introduction to Genetic Analysis and Exploitation in Eukaryotes.
Blackwell Scientific Publications.
Kok, E.J., Noteborn, H.P.J.M and Kuiper, H.A. (1994) Food safety
assessment of marker genes in transgenic crops. Trends in Food
Science and Technology 5, 294–298.
Koziel, M.G., Beland, G.L., Bowman, C. et al. (1993) Field performance of elite transgenic maize plants expressing an insec-
ticidal protein derived from Bacillus thuringiensis. Bio/technology
11, 194–200.
Leenhouts, K.J., Kok, J. and Venema, G. (1991) Replacement
recombination in Lactococcus lactis. Journal of Bacteriology 173,
4769–4798.
Lloyd-Evans, L.P.M. (1994) Biotechology-derived foods and the
battleground of labelling. Trends in Food Science and Technology
5, 363–367.
Malik, V.S. and Wahab, S.Z. (1993) Versatile vectors for expressing
genes in plants. Journal of Plant Biochemistry and Biotechnology
2, 69–70.
MacCormick, C., Griffin, H.G. and Gasson, M.J. (1996) Construction of a food-grade host/vector system for Lactococcus lactis
based on the lactose operon. FEMS Microbiology Letters 127,
105–109.
Maguin, E., Provost, H. and Gruss, A. (1996) Construction of foodgrade mutants of lactic acid bacteria. Lait 76, 139–146.
McElroy, D. and Brettel, R.I.S. (1994) Foreign gene expression in
transgenic cereals. Trends in Biotechnology 12, 62–68.
Moffatt, B.A., Dunn, J.J. and Studier, F.W. (1984) Nucleotide
sequence for the gene for bacteriophage T7 RNA polymerase.
Journal of Molecular Biology 173, 265–269.
Payne, J., MacCormick, C., Griffin, H.G. and Gasson, M.J. (1996)
Exploitation of the lactose operon for controlled stabilized
expression of heterologous genes in Lactococcus lactis. FEMS
Microbiology Letters 136, 19–24.
Platteeuw, C., Simons, G. and de Vos, W.M. (1995) Use of the E.
coli b-glucuronidase (gusA) gene as a reporter gene for analysing
promoters in lactic acid bacteria. Applied Environmental Microbiology 60, 587–593.
Platteeuw, C., van Alen-Boerrigter, I., van Schalwijk, S. and de
Vos, W.M. (1996) Food-grade cloning and expression system for
Lactococcus lactis. Applied Environmental Microbiology 62, 1008–
1013.
Pouwels, P.H., Enger.Valk, B.E. and Brammar, W.J. (1985) Cloning
Vectors : A Laboratory Manual. Amsterdam, New York, Oxford :
Elsevier.
Reiser, J., Glumoff, V., Kälin, M. and Ochsner, U. (1990) Transfer
and expression of heterologous genes in yeasts other than Saccharomyces cerevisiae. Advanced Biochemical Engineering Plant
Biotechnology, Vol. 1 ed. Grierson, D. pp. 82–104. New York :
Blackie and Son, Chapman and Hall.
Romanos, M.A., Scorer, C.A. and Clare, J.J. (1992) Foreign gene
expression in yeast: a review. Yeast 8, 423–488.
Sambrook, J., Fritsch, E.F. and Maniatus, T. (1989) Molecular
Cloning : A Laboratory Manual, 2nd edn. Cold Spring Harbor,
NY : Cold Spring Harbor Laboratory.
Simon, D. and Chopin, A. (1988) Construction of a vector plasmid
family and its use for molecular cloning in Streptococcus lactis.
Biochemie 70, 559–566.
Struhl, K., Stinchcomb, D.T., Scherer, S. and Davies, R.W. (1979)
High frequency transformation of yeast : autonomous replication
of hybrid DNA molecules. Proceedings of the National Academy
of Sciences USA 76, 1035–1039.
Sturley, S.L. and Young, T.W. (1986) Genetic manipulation of
commercial yeast strains. Biotechnology and Genetic Engineering
Review 4, 1–38.
Thompson, C.J., Movva, N.R., Tizard, R. et al. (1987) Charac-
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980
980 C .A . M A CC OR M IC K E T AL .
terization of the herbicide-resistance gene bar from Streptomyces
hygrscopicus. EMBO Journal 6, 2519–2523.
Toepfer, R., Matzeit, V., Gronenborn, B., Schell, J. and Steinbiss,
H.H. (1987) A set of plant expression vectors for transcriptional
and translational fusion. Nucleic Acids Research 15, 5890.
Tschumper, G. and Carbon, J. (1980) Sequence of a DNA fragment
containing a chromosomal replicator and the TRP1 gene. Gene
10, 157–166.
Tuite, M.F. (1992) Strategies for the genetic manipulation of
Saccharomyces cerevisiae. Critical Reviews Biotechnology 12, 157–
188.
Van de Guchte, M., Kok, J. and Venema, G. (1992) Gene expression
in Lactococcus lactis. FEMS Microbiology Review 88, 73–92.
Vieira, J. and Messing, J. (1982) The pUC plasmids, an M13mp7-
derived system for the insertion mutagenesis and sequencing
synthetic universal primers. Gene 19, 259–268.
Warmington, J.R., Waring, R.B., Newlon, C.S., Indge, K.J. and
Oliver, S.G. (1985) Nucleotide sequence characterization of Ty
1-17, a class II transposon from yeast. Nucleic Acids Research 13,
6679–6693.
Widdowson, C.A., Klugman, K.P. and Hanslo, D. (1996) Identification of the tetracycline resistance gene tet (0) in Streptococcus
pneumoniae. Antimicrobial Agents Chemotherapy 40, 2891–2893.
Wells, J.M., Wilson, P.W., Norton, P.M., Gasson, M.J. and Lepage,
R.W.F. (1993) Lactococcus lactis : high level expression of tetanus
toxin fragment C and protection against lethal challenge. Molecular Microbiology 8, 1155–1162.
© 1998 The Society for Applied Microbiology, Journal of Applied Microbiology 84, 969–980