Download Biology II (Block III)

Biology II (Block III)
Importance of Biotechnology
Diagnostic Activity (2.1).
What is biotechnology?
What are transgenic organisms?
Are they dangerous?
- Transgenic Animals
- Transgenic Plants
Have you ate genes?
Which are some ethical issues related to this topic?
Biotechnology
Bio: Life
Technology: is the making, usage,
and knowledge of several things in
order to solve a problem or perform
a specific function.
Biotechnology: usage of living
organisms, its parts or its processes
to carry out specific functions or
solve problems.
Oldschool biotechnology
Agriculture
Oldschool biotechnology
Brewing beer
Glycolisis
glucose
2
2
NAD+
ADP
NADH
2
ATP
2 pyruvic acid
2
2
NADH
NADH
2
2CO2
2
NAD+
NAD+ 2
2 ethyl alcohol
Alcohoic
Fermentation
2 Lactic acid
Lactic Acid
Fermentation
Oldschool biotechnology
Leavened bread
Glycolisis
glucose
2
2
NAD+
ADP
NADH
2
ATP
2 pyruvic acid
2
2
NADH
NADH
2
2CO2
2
NAD+
NAD+ 2
2 ethyl alcohol
Alcohoic
Fermentation
2 Lactic acid
Lactic Acid
Fermentation
Oldschool biotechnology
It is unknown when does humanity started using it but we know
that has been existing for a very long time.
In most of the cases we were using it without even knowing
what was happening.
It was used mostly for human consumption. As food.
DNA
Identifying the substance of genes.
Griffith Experiment.
Griffith was a british scientist
trying to understand how bacteria
make people sick, more
specificallt he wanted to learn
how certain types of bacteria
produce the serious lung disease
known as pneumonia.
Identifying the substance of genes.
Transformation
Griffith reasoned that somehow, the heat-killed
bacteria passed the disesase-causing ability to the
harmless bacteria. He called this process
Transformation. And he concluded that the
transforming factor must be the gene.
Avery Experiment.
A group of
scientist led by
Oswald Avery,
wanted to
determine which
molecule in the
heat killed
bacteria was
most important
for the process of
transformation.
Avery Experiment.
By observing bacterial transformation, Avery and
other scientists discovered that the nucleic acid
DNA stores and transmits the genetic information
from one generation of bacteria to the other one.
The Role of DNA
What is the role of DNA in heredity?
Storing information
•
Cellular respiration
•
Mitosis
•
Immune system
Copying information
•
Cell cycle
–
S phase
Transmitting information
The structure of DNA
The Components of DNA
Deoxyribonucleic Acid , or DNA, is a unique
molecule indeed. DNA is a nucleic acid made
up of nucleotides joined into long strands or
chains by covalent bonds.
The Components of DNA
Nucleic acids:
Long acidic molecules originally identified in cell
nuclei.
Like most macromolecules, they are made up of
smaller sub units linked together to form chains.
This subunits are called nucleotides and are made
up of 3 basic components.
The components of DNA
Nucleotide:
• 5-carbon sugar called deoxyribose
• Phosphate group
• Nitrogenous Base
Components of DNA
Nitrogenous Bases
- Bases that contain Nitrogen
- 4 Kinds (A, G, C and T):
-
Adenine
Guanine
Cytosine
Thymine
Components of DNA
- The nucleotides in a
strand of DNA are joined by
covalent bonds between
the P group and the sugar.
- The nucleotides can be
joined together in any order
AGCCCTTTAAGCATAGTTTAGA
Solving the Structure of DNA
Knowing that DNA is made u of chains of nucleotides was just the
begining of understranding the structure of this molecule. The next
step is related to the understanding of this molecule´s structure in 3
dimensions.
Chargaff´s Rule:
An Austrian-American Biochemist, Erwin Chargaff, discovered that the
percentages of thymine and adenine bases where almost the same on
any DNA sample. The same thing is true for Cytosine and Guanine.
The observation that %A = %T and
%G = %C is known as Chargaff´s rule
Solving the structure of DNA
Franklin´s X-rays:
The british scientist Rosalind Franklin was working with DNA
and X rays, she was able to obtain an image of the DNA
based on the diffraction of X rays.
- The image showed that the DNA strands are twisted
forming a helix
- And also suggest that the nitrogen bases are located near
the center of the DNA molecule.
Solving the structure of DNA
The work of Watson and Crick:
- The clues in Franklin´s X-Ray pattern
enabled Watson and Crick to build a
model that explained the specific
structure and properties of DNA
- Watson and Crick´s breakthrough
model of DNA was a double helix, in
which two strands of nucleotide
sequences were wound around each
other.
The Double Helix Model
The model proposed by Watson and Crick
explain many of the most important
properties of DNA.
• The double helix model explains chargaff´s
rule of base pairing and how the two
strands of DNA are held together.
• It also tell us how DNA can function as a
carrier of genetic information.
Antiparallel strands:
The 2 strands of DNA that make up the
molecule run in opposite directions, they are
antiparallel.
The double Helix Model
Hydrogen Bonding:
• The two strands of DNA are
held together by slight forces
made between some
nitrogenous bases, this forces
are known as Hydrogen
Bonds.
• The forces that held this
strands together should be
“weak” enough so that they
can be separated only when
needed without using a lot of
energy.
The Double Helix Model
Base Pairing:
A and T : 2 hydrogen bonds
G and C : 3 hydrogen bonds
Waton and crick realized that
this base pairing explained
Chargaff´s rule
Activity II.3
1) List the chemical components of DNA.
2) Why are hydrogen bonds so essential to the structure of
DNA?
3) Describe the discoveries that led to the modeling of
DNA.
4) Why dos scientists have to use other tools rather than
microscopes to solve the structure of DNA?
5) Describe Watson and Crick´s model of the DNA
molecule.
6) Did Watson and Crick´s model account for the equal
amounts of thymine and adenine? Explain.
DNA Replication
Copying the code
When Watson and Crick discovered the structure of DNA,
they immediately recognized one genuinely surprising
aspect of the structure. Base pairing in the double helix
explains how DNA can be coied, or replicated, because each
base on one strand pairs with one – and only one – base on
the opposite strand
The replication process
Before cells divide they duplicate its DNA through a copying process
called replication.
During this process the DNA molecule seperates into two strands and
then produce two new complementary strands following the rules of
base pairing.
Each strand of the double helix of DNA serves as a template or model
for the new strand.
The Replication Process
The role of Enzymes
These process of DNA replication is carried out by a series of
enzymes which first unzip a molecule of DNA by breaking
the hydrogen bonds between base pairs and unwinding the
two strands of the molecule.
*Enzymes are proteins with highly specific functions.
The principle enzyme involved in the DNA replication is
called DNA polymerase which joins individual nucleotides
to produce a new strand of DNA.
-
The role of enzymes
Besides producing the phosphate-sugar bond between the
nucleotides, DNA polymerase also proofreads each new
DNA strand, so that each molecule is a near-perfect copy of
the original.
Telomeres
DNA tips of chromosomes are known as telomeres, which is
particularly difficult to replicate. Cells use a special enzyme
called telomerase, to solve this problem by adding short
repeated sequences of DNA to the telomeres
DNA replication in prokaryotes and
eukaryotes
• Eukaryotes have more DNA, closely to 1000 times more.
• In eukaryotes most is find on the nucleus packaged as
chromosomes.
• In prokaryotes there´s only one origin of relication.
• Eukaryotes have several origins of replication.
DNA replication mistakes
Although a number of proteins check the DNA for chemical
damage or base pairing mis matches, prior to replication,
the system is not foolproof.
Damaged regions of the DNA are sometimes replicated,
resulting in changes to DNA base sequences that may alter
certain genes and produce serious consequences.
Activity II.4
1) How is DNA replicated? Explain.
2) What is the role of the DNA polymerase in DNA
replication. 2 things.
3) Where and in what form is prokaryotic DNA found?
Where is eukaryotic DNA found?
4) What would be the result of damaged, and not fixed,
DNA being replicated. Remember mitosis and meiosis.
5) Make a DNA template using all the As, Ts, Gs and Cs
found in this slide in the order that they appear. After
this, write down which wolud be the complementary
strand, as if you where the DNA polymerase, using base
pairing.
The Role of RNA
Comparing RNA and DNA
1) RNA is also a nucleic acid and just as DNA is made up of
nucleotides. But there are small differences between the
nucleotides of RNA from the ones of DNA
DNA
RNA
Sugar: Deoxiribose
Sugar: Ribose
Bases: A, G, C and T
Bases: A, G, C and U (uracil)
2) Another difference between RNA and DNA is that RNA,
in most cases, is single stranded.
The Role of RNA
Comparing RNA and DNA
1) How else can we explain the difference between RNA
and DNA?
The Role of RNA
Functions of RNA
1) You can think of RNA as a disposable copy of a segment
of DNA. RHA has many functions, but most RNA
molecules are involved in just one job – protein
synthesis.
2) Protein synthesis requires of 3 different kinds of RNA
1) Messenger RNA (mRNA)
2) Ribosomal RNA (rRNA)
3) Transfer RNA (tRNA)
The Role of RNA
Functions of RNA
1) Messenger RNA: as its name says these are molecules of
RNA that carry the instructions to build proteins found
in genes. They carry the information from DNA (indide
the nucleus) to other parts of the cell.
2) Ribosomal RNA: proteins ar assembled on ribosomes,
small organelles composed of two subunits. These
subunits are made up of several ribosomal RNA
molecules and as many as 80 different proteins.
The Role of RNA
Functions of RNA
3) Transfer RNA: when a
protein is built, a third type
of RNA molecule transfers
each amino acid to the
ribosome as it is specified
by the coded messages in
mRNA. These molecules
are known as transfer RNA.
RNA synthesis
Transcription
Most of the work of RNA takes place during transcription. In
transcription, segments of DNA serve as templates to
produce complementary RNA molecules.
In prokaryotes, RNA synthesis an protein synthesis take
place in the cytoplasm. In eukaryotes, RNA is produced in
the cell´s nucleus and then moves to the cytoplasm to play a
role in the production of protein.
RNA synthesis
Transcription
The enzyme related in the process of transcription is called
RNA polymerase. Just as in DNA replication, in RNA a RNA
polymerase attaches to a DNA template but instead of
making a DNA copy, it transcripts the information from DNA
to RNA.
Promoters: How does RNA polymerase know where to start
and top making a strand of RNA?
RNA Synthesis
Promoters
The RNA polymerase doesn´t attach randomly to the DNA, it
attaches to a specific place on the DNA molecule known as
the promoter
RNA Editing
Before the RNA molecule is ready to take the message from
the DNA to the ribosomes, it needs to be edited, this RNA is
known as pre-mRNA.
RNA Synthesis
Editing
In order to be “edited” the RNA needs to remove some
regions of this pre-mRNA molecule known as introns.
After these segments are removed only the regions of the
RNA that are important for the protein synthesis remain.
These regions are known as exons.
Activity 5
1.
2.
3.
4.
Describe 3 main differences between DNA and RNA.
List the 3 types of RNA and explain what they do.
Describe what happens during transcription.
What do you think will happen if introns are not
removed from the pre-mRNA?
Ribosomes and Protein Synthesis
The Genetic Code
Polypeptide: long chains of amino acids joined together.
As many as 20 different AA are found on polypeptides.
What would determine the properties of different proteins?
- The specific AA present on the polypeptide
- The order of the AA
Lys
Lys
Lys
Met
Lys
Lys
Lys
Lys
Met
Met
Lys
Met
The Genetic Code
How is the order of bases in DNA and RNA
molecules translated into a particular order
of AA in a polypeptide?
Theres a lenguage used by the cells in order to know how to
make this. This lenguage use “4 letters” A, G, C and U to
make “words” and it is called Genetic Code. The “words” will
always be read in groups of 3 letters and any possible
combination of this 4 letters, making words of 3 letters in
any order, will be specific for a determined AA. These 3letter “words” are called: codons.
The Genetic Code: ¿How to read the codons?
- AA can be
repeated for
different codons.
- AA can have
only one codon
- Start and stop
codons?
The Genetic Code: ¿How to read the codons?
Translation
Ribosomes use the sequences
of codons in mRNA to assemble
AA into polypeptide chains.
The decoding of an mRNA
message into a protein is a
process known as Translation.
Translation: Steps
Step 1:
Translation begins when a ribosome attaches to a mRNA
molecule in the cytoplasm. As each codon passes through
the ribosome, tRNAs bring the propper AA into the
ribosomes. One at a time the ribosomes then attaches
these AAs to the growing chain.
Each tRNA molecule carries just oe kind of AA. In addition,
each tRNA molecule has three unpaired bases, collectively
called anticodon. Each tRNA anticodon is complementary to
one mRNA codon.
Translation: Steps
Step 2: As the ribosome continues reading the message
from the mRNA, the tRNA that are being called bring
specific AAs depending on the information of the mRNA and
the ribosomes start making chains of these.
Step 3: The polypeptide chain continues growing until the
ribosome reaches a “stop” codon on the mRNA molecule.
After this the ribosome releases both the mRNA and the
polypeptide chain and disassembles.
Translation: Steps
Activity 6
What are codons and anticodons?
What happens during translation?
Why can cells produce DNA starting from a RNA template,
but cannot synthetise a RNA or DNA molecule using the
information of a template made of AAs?
Use this molecule to obtain the RNA molecule and the
polypeptide chain.
DNA: GGGCCTACCCTACGGTTAGCCGGGTTGGGCCCTGCTACTGG
RNA:
Pro:
Mutations
Types of Mutations
Mutations: heritable changes in genetic information
2 main types:
- gene mutations
- chromosomal mutations
Gene mutations
point mutations
1) Insertions and deletions
are also called framshift
mutations.
Chromosomal Mutations
Effects of mutations
1) Genetic material can be altered by natural means
(mistakes made by the DNA/RNA polymerase) or by
artificial means (caused by human activity). The
resulting mutations may or may not affect the organism.
Many mutations are produced by errors in genetic
processes.
- Point mutations: Replication/Transcription
- Chromosomal mutations: ????????
Effects of mutations
1) Mutagens: Chemical or physical agents from the
environment that cause mutations.
Chemical: Tobacco smoke, smog, etc.
Physical: Radiation, UV rays, Gama rays, X rays, etc.
The effects of mutations on genes vary widely. Some have
little or no effect; and some produce benefical variations.
Some negatively disrupt gene function.
Effects of mutations
1) Benefical effects: Mutations often produce proteins with
new or altered functions that can be useful to organisms
in different or changing environments.
Activity 7
1)
2)
3)
4)
Describe the 2 main types of mutations
What is a frameshift mutation?
List three effects mutations can have on genes.
What is the significance of mutations to living things?
Activity 8
Make a summary of a page long including all the topics and
keyconcepts that we have seen until now. Be sure to
highlight or underline the keyconcepts and topics.
From molecule to phenotype
How do small changes in DNA molecules affect human
traits?
We know that genes are made up of DNA and that they
interact with the environment to produce an individual
organsim´s characteristics, or phenotype. However when a
gene fails to work or works improperly, serious problems
can result.
From molecule to phenotype
There´s a direct link between genotype and phenotype, for
example:
Ear wax
Dry
earwax
Wet
earwax
From molecule to phenotype
A simple base change from guanine (G) to adenine (A)
causes this protein to produce dry earwax instead of wet
earwax.
The conection between molecule and trait, and often
between genotype and phenotype, is often that simple, and
just as direct. Changes in a gene´s DNA sequence can
change proteins by altering their aminoacid sequences,
which may directly affect one´s phenotype.
Disorders caused by individual
genes
Sickle cell disease
This disorder is caused by a defective allele for beta globin,
one of the two polypeptides in hemoglobin, the oxygencarrying protein in red blood cells.
The defective protein makes hemoglobin a little bit less
soluble causing hemoglobin molecules to stick together
when blood´s oxygen level decreases. The molecule clump
into long fibers, forcing cells into a distinctive sickle shape,
which gives the disroder its name
Disorders caused by individual
genes
Disorders caused by individual
genes
Cystic fibrosis
Is caused by a genetic change. In most cases it results from
the deletion of just three bases in the gene for a protein
called cystic fibrosis transmembrane regulator (CFTR). CFTR
normally allows chloride ions (Cl-) to pass across cell
membranes. The loss of the three bases remove a single
aminoacid (Phe) from CFTR, causing the protein to fold
improperly and thus being destroyed. With the cell
membranes unable to transport chloride ions, tissue
throughout the body malfunction.
Disorders caused by individual
genes
Children with CF have serious digestive problems and
produce thick, heavy mucus that clogs their lungs and
breathing passageways
Huntington´s disease
It is caused by a dominant allele for a protein found in brain
cells. The allele for this disease contains a long string of
bases in which the codon CAG-coding for the aminoacid
glutamine – repeats over and over again more tha 40 times.
This disease causes mental deterioration and uncontrollable
movements, ussually do not appear until middle age, the
greater the number of codons the earlier the disease
appears, and the more severe are its symptoms.
Huntington´s disease
Chromosomal disorders
What are the effects of errors in meiosis?
The most common error in meiosis occurs when
homologous chromosomes fail to seperate. This mistake is
known as nondisjunction.
If nondisjunction occurs during meiosis, gametes with
abnormal # of chromosomes may result, leading to a
disorder of chromosome number.
Chromosomal disorders
Trismoy 21 (Down´s Syndrome)
Chromosomal disorders
Non disjunction of the X chromosome can lead to a disorder
known as Turner´s syndrome. A female with this syndrome
usually inherits only one X chromosome, which means they
would be sterile. Their sex organs do not develope during
pubery.
In the case of men, the nondisjunction of chromosome X
causes the Klinefelter´s syndrome which means that this
people have 3 X chomosomes interfering with meiosis and
preventing these individuals from reproducing.
Activity 9
1) How can a small change on a person´s DNA cause a
genetic disorder?
2) Describe 2 sexual chromosomal disorders.
3) How does nondisjunction causes a chromosomal
disorder?
4) What causes Cystic Fibrosis?
5) What causes Sickle Cell disease?
Crops
(maize)
Also known as “corn”, maize constitutse
a staple food in many regions of the
world. Introduced into Africa by the
Portuguese in the 16th century, maize
has become Africa's most important
staple food crop.
Maize is used world wide in many ways,
being as food one of the most important
uses of mankind.
Crops
(maize)
Other uses:
Plagues:
•
•
•
•
•
•
•
•
•
•
•
•
•
Crops
(maize)
Insects
Corn earworm (Helicoverpa zea)
Fall armyworm (Spodoptera frugiperda)
Common armyworm (Pseudaletia unipuncta)
Stalk borer (Papaipema nebris)
Corn leaf aphid (Rhopalosiphum maidis)
European corn borer (Ostrinia nubilalis) (ECB)
Corn silkfly (Euxesta stigmatis)
Lesser cornstalk borer (Elasmopalpus lignosellus)
Corn delphacid (Peregrinus maidis)
Western corn rootworm (Diabrotica virgifera virgifera LeConte)
Southwestern corn borer (Diatraea grandiosella)
Maize weevil (Sitophilus zeamais)
Oil spills
An oil spill is the release of
a liquid petroleum hydrocarbon into the environment,
especially marine areas, due to human activity, and is a
form of pollution. The term is mostly used to
describe marine oil spills, where oil is released into
the ocean or coastal waters.