* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 1) Lecture notes: mechanisms of gene activation
Metagenomics wikipedia , lookup
Genetic code wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Transposable element wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA vaccination wikipedia , lookup
Gene expression profiling wikipedia , lookup
Molecular cloning wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Human genome wikipedia , lookup
Transcription factor wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Epigenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polyadenylation wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Designer baby wikipedia , lookup
RNA interference wikipedia , lookup
Point mutation wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Non-coding DNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
RNA silencing wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Epitranscriptome wikipedia , lookup
Helitron (biology) wikipedia , lookup
Non-coding RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nutrition and Gene Expression Lecture, part 1, Feb 5, 2015 Overview: Gene Activation WHAT IS A GENE? •A gene is usually defined as sequence of DNA that codes for a protein. Control elements are also part the gene, and are critical to regulation of its expression •The coding sequence is first read into an RNA sequence, which is processed to a message (mRNA). This is called TRANSCRIPTION. •The mRNA is then read by ribosomes to make the protein. This is called TRANSLATION. The basic structure of genes of course is DNA. Standard cartoon view View that shows base pairing In a textbook, this strand is shown: “Coding strand” This is the “Template strand”, which is used to make an RNA copy. In this case, the Codon “CUA” will code for Leucine CODING STRAND: template for RNA synthesis HYPOTHETICAL SMALL CHROMOSOME: Double-stranded DNA, 1 million base pairs long A B C D E These 5 genes (A-E) occupy only 100,000 base pairs (about (20,000/gene). The DNA in between has roles to be defined. A B C D E Let’s focus on one gene, B. Region that is read into primary RNA transcript SIMPLIFIED STRUCTURE FOR A GENE Transcription factor binds here ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA Sequence to be copied into RNA If there is a protein transcription factor to bind to the RED DNA SEQUENCE, then the GREEN SEQUENCE will uses as a template for a primary RNA transcript. THE STRANDS SEPARATE BEFORE RNA IS MADE! WHAT IS TRANSCRIPTION? The synthesis of a complementary RNA strand, that matches the sequence of the DNA strand. This is the process where most regulation occurs, during gene expression. This will be illustrated with some very simple examples of this process. Coding strand: If a textbook shows only one sequence, it will be this strand. It’s the same as the RNA transcript, except that the RNA has U instead of T. DNA: ATATGCTACAGCGCATAT RNA: AUAUGCUACAGCGCAUAU DNA: TATACGATGTCGCGTATA Template strand: used by RNA-polymerase-II to make a complementary RNA copy Thymine (T) Uracil (U) RNA: AUAUGCUACAGCGCAUAU DNA: TATACGATGTCGCGTATA During RNA synthesis: A pairs with T on the DNA U pairs with A C pairs with G G pairs with C Like DNA double strand, except RNA has U instead of T. THE CORE QUESTION IN REGULATION OF GENE EXPRESSION – IS THERE A PROTEIN TRANSCRIPTION FACTOR TO START RNA SYNTHESIS? Otherwise, the DNA is usually not transcribed into RNA. In a typical cell, manyof the genes (about 60%) are hardly ever transcribed. TRANSCRIPTION FACTORS THEMSELVES ARE PROTEINS. THESE PROTEINS FUNCTION TO ACTIVATE THE GENES THAT MAKE OTHER PROTEINS. EFFECTS OF BINDING OF SPECIFIC TRANSCRIPTION FACTOR (TF) A) TF protein binds to CONTROL SITE ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA B) RNA Pol-II binds to the START SITE Pol-II ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA RNA SEQUENCE, COMPLEMENTARY TO DNA, IS MADE AS POL-II MOVES ALONG DNA SEQUENCE AU ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA AUAUGC ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA AUAUGCUACAGCGCAUAU ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA TRANSCRIPTION COMPLETE ATGCTAATGTGCCTATATACGATGTCGCGTATAATTGAT TACGATTACACGGATATATGCTACAGCGCATATTAACTA AUAUGCUACAGCGCAUAU Primary transcript made, ready for splicing and translation NOTE: RNA-Pol-II will fall off the gene, and can then start transcription again. FRUCTOSE METABOLIC PATHWAY: WHY ALDOLASE B IS NEEDED FROM DIET ALDOLASE B NEEDED AT THIS STEP For discussion of the papers on hereditary fructose intolerance, we will review a database maintained on this disorder at Boston University: http://www.bu.edu/aldolase/HFI/hfidb/hfidb.html