* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Unit 7 Study Guide ANSWERS 2014
Community fingerprinting wikipedia , lookup
RNA interference wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Molecular cloning wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Gene regulatory network wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Biochemistry wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Messenger RNA wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Molecular evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding RNA wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Epitranscriptome wikipedia , lookup
Unit 7 Study Guide 1. The central dogma of molecular biology states that information flows in one direction from DNA to RNA to proteins. 2. Write the nucleotide sequence of the RNA strand that would be complementary to the following DNA strand: GTAGTCA. CAUCAGU 2. The main function of tRNA is to bring the amino acids to the ribosome. 3. What events occur directly after RNA polymerase recognizes the transcription start site of a gene? Creates an mRNA molecule from a DNA template by bonding RNA nucleotides (A, U, G, C) 4. A primary difference between transcription and replication is that transcription produces a complementary strand of RNA. 5. What is the term for a three-nucleotide sequence that codes for an amino acid? codon 6. How many amino acids are used to make up the all of the proteins in the human body? 20 7. Define translation. Converts mRNA into a polypeptide (protein) 8. Where is the site of translation? Ribosome in the cytoplasm 9. Which process makes use of tRNA? Translation 10. What determines the specificity of a protein? The order of the nitrogenous bases in the DNA 11. In a eukaryotic cell, where does mRNA processing take place? During Transcription 12. What are the two processes that link the gene to the protein? Transcription and Translation 13. Proteins are made up of long chains of amino acids. 14. Generally, mutations that affect a single gene occur during cell replication (Meiosis and Mitosis) 15. Mutations that can affect the offspring of an organism occur in what cell type? Germ/Sex Cells 16. Give an example of a mutagen? UV light, radiation 17. Define gene. A segment of DNA that contains the information necessary to produce a protein 18. Where are genes located? Chromosomes 19 Where is DNA located in the cell? Nucleus 20. What cell organelle is responsible for assembling proteins? Ribosomes 21. What is a mutation? An error in the DNA code that makes up a gene 22. DNA strand #1: AGCTGCTAGCTAACGTTCGACC DNA strand #2: TCGACGATCGATTGCAAGCTGG mRNA: UCGACGAUCGAUUGCAAGCUGG use DNA strand #1 Protein: Ser-Thr-Iso-Asp-Cys-Lys-Leu-G use chart 23. Write the steps of protein synthesis in order: 1. Messenger RNA moves from the nucleus to the cytoplasm 2. Messenger RNA attaches to a ribosome 3. Transfer RNA bonds to a specific codon 4. Amino acids are bonded together