* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Document
SNP genotyping wikipedia , lookup
Oncogenomics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Primary transcript wikipedia , lookup
Genome evolution wikipedia , lookup
Genomic library wikipedia , lookup
Molecular cloning wikipedia , lookup
Human genome wikipedia , lookup
Epigenomics wikipedia , lookup
DNA vaccination wikipedia , lookup
Genetic engineering wikipedia , lookup
Genome (book) wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA supercoil wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Microsatellite wikipedia , lookup
Genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Designer baby wikipedia , lookup
Non-coding DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genome editing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Helitron (biology) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Microevolution wikipedia , lookup
DNA and Genes Thing to find out: • • • • • What is DNA? The Genetic code The Human genome Passing on the genomic information Inheritance patterns Diversity of Life • All biological systems are composed of the same types of molecules • Similar organization priciples are used at the cellular level The Cell • Basic component of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus • Prokaryotes lack a defined nucleus and have a simplified internal structure • Eukaryotes have membrane limited nucleus and more complicated internal structure • Three branches of life • Genetic material is located to the nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains all the information needed to build an individual What is DNA needed for? •Genetic information is used for gene expression •Information of a gene is transferred from DNA and converted to protein •RNA molecules work as messangers •Proteins are the biological workers •Information of the DNA is copied by directing the synthesis of a RNA molecule in a process called transcription •RNA directs the protein synthesis in a translation •Protein’s 3D structure determines it’s function •Information can transfer only in one direction DNA (Deoxyribo Nucleic Acid) •DNA is a polymer of nucleotide monomers •2’-deoxyribose sugar Base part •Four bases: •Adenine, A •Guanine, G •Thymine, T •Cytosine, C • Together a sugar and a base are called a nucleoside Sugar part Four bases... Purine bases • Adenine and guanine • Two carbon rings Pyrimidine bases • Thymine and cytosine • A single carbon ring DNA chains • Nucleosides are joiden together with phospsodiesteri bond • Sequence of bases vary  genetic information • Chains are extremely long! DNA Molecules • DNA molecules are composed of two polynucleotide chains • Double helix, twisted in right handed way • Twists a full circle in every 10 bases •”ladder-structure” –Bases = steps –Sugars and phosphates = suporting pilars •Two nucleotide chains run in opposite directions  chemical direction Complementary Pairing • Bases interact with other bases • Purines with two carbon rings interact only with single ring pyrimidines  Space between the chains is limited. • AT • GC • Complementary pairing  Vital for retainins of the genetic information! •Interaction is stabilized by hydrogen bonds •A-T bond  two hydrogen bonds •G-C bond  three hydrogen bonds The Genetic Code • Describes how base sequences are converted to protein sequence • DNA sequence is divided into series of units of three bases  a codon • One codon is spesific to one amino acid ( structural component of protein) • The four bases can form 64 codons • 20 amino acids are found from the nature • Codons hava also alternative functions needed to regulate protein synthesis •Right reading frame is obligatory!!! •Sequence of human HCR gene, which assosiates with psoriasis atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc •Many different reading frames can be used, but only one is the right one •Transleate tools can found form the internet Frame 1 The right one Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I PLVQ Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F PWSN Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H Genes • Genetic information is encoded in the base sequence of the DNA • A gene : DNA sequence that encodes amino acid sequence of a protein • Beside the coding area, also other elements are needed  control elements and ”empty areas” • Genes vary a lot in size •Genes are separeted from each others by sequences which function is unknown •Only other strand of the DNA carries biological information  template strand •Potential to store biological information is enormous Chromosome Condenced scaffold fibers connected to chromosome scaffold chromatin fibers chromatin DNA Mutations • Mutations are alterations in DNA sequence • Many chemical and physiological agents and errors in DNA replication • Cells can repaire some mistakes •Once introduced and not repaired, changes in DNA sequence are made permanent by DNA replication Sequence variations: Single nucleotide polymorphims: Alteration of a single base  1. Causes an alteration in the amino acid that the codon codes 2. Does not cause alteration on the amino acid that the codon codes 3. Alters codon in the way that it becomes stop-codon for protein synthesis • Frameshift mutation: insertion/deletion of bases  reading frame is alterered The Human Genome The different types of sequences that make up the total DNA of a human cell The Human genome... • 3 billion base pairs • about 30000 genes • 23 chromosome pares  46 chromosomes • 25 % of the DNA is gene related • Only 5 % encodes proteins • Genes include exons and introns • Beside coding areas also additional secuences are found Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in the DNA Phenotypes Genotype GCCAAGAATGGCTCCCACC T GGCTCTCAGACATTCCCCT GGTCCAACCCCCAGGCCAT CAAGATGTCTCAGAGAGGC GGCTAGACACCCAGAGACC TCAAGTGACCATGTGGGAA CGGGATGTTTCCAGTGACA GGCA Genotype ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTC C CACTTTCAAGCTCGGCCCCT T TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG Passing on the genetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develope All somatic cells • 46 chromosomes • Diploid cells, 2n Sperm cell • 23 chromosomes • Haploid cell, n Egg cell • 23 chromosomes • Haploid cell, n Fertilization: + n n Fertilized egg • 2n • 46 chromosomes Mitosis • Every cell division • The number of chromosomes does not change • DNA dublicates before entering the mitosis • Takes 1-2 hours Meiosis • Nuclear division • Only in gamete formation • Results formation of the haploid gametosytes • Mature gametocytes have 23 chromosomes (n) Humans •46 chromosomes ( 44 autosomes, 2 sex chromosomes) •X and Y –chromosomes •XX  female •XY  Male The chromosome pare: • A locus • An allele • Heterozygous (Aa) • Homozygous (AA or aa) •We have two copies of each gene, one from the mother and one from the father  Genotype • Dominant character: only one allele needed to cause the phenotype (heterozygous) • Recessive character: both allels needed to cause the phenotype (homozygous) Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from a parent to a offspring • Monogenic diseases: disease is caused by mutation in one gene •Multifactioria diseases: disease is caused by co-operative action of different mutations in different genes and environmental factors • Mendelian inheritance: Presence or absence depends of the genotype at the single locus Autosomal dominant inheritance: Autosomal recessive inheritance: X-chromosome linked recessive inheritance: X-chromosome linked dominant inheritance:
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            