Download Genetic Epidemiology of High Blood Pressure in Chinese

Major Components of a
Gene

Promoter: The DNA region that signal initiation of
transcription

5’-Untranslated Region: A short DNA
sequence rich in GC pairs present in the 5’-flanking
region of the gene

Exon: Segment of a gene which is decoded to
give an mRNA product or a mature mRNA product
Major Components of a
Gene

Intron: Noncoding DNA which separates
neighboring exons in a gene

3’-Untranslated Region: A short DNA sequence
in the 3’-flanking region of the gene that contains
polyadenylation signal

Codon: A nucleotide triplet which specifies an
amino acid or a signal for terminating the synthesis
of a polypeptide
The Genetic Code

Three-nucleotide sequences (codons) control
selection of amino acids for protein synthesis

Four kinds of Nucleic acids in mRNA:
Adenine, Guanine, Uracil, Cytosine

Commaless and nonoverlapping within a
reading frame
The Genetic Code

Non-ambiguous (no codon is specific for two
different products)

Redundant (or Degenerate)

Code degeneracy usually in the third position
of the codon
Major Components of a
Gene
Open reading frame (ORF): A long sequence
of DNA in which there are no termination
codons
 Example:

5’…TGTCCCGGCATGGATATCCGGAACAACCTCACTAGG…3'
…CysProGlyMetAspIleArgAsnAsnLeuThrArg…
Gene Transcription
 5’-Capping
 3’-Polyadenylation
 Intron
Splicing
Basic Concepts in
Gene Mapping
 genomic
DNA: the entire complement of
genetic material
 mRNA: RNA that is transcribed from the
genomic DNA of a gene
 cDNA: DNA which is synthesized by the
enzyme reverse transcriptase using mRNA
as a template
Basic Concepts in
Gene Mapping
Genomic DNA
Transcription
mRNA
Reverse
Transcription
cDNA
Basic Concepts in
Gene Mapping
Genomic DNA
Transcription
Pre-mRNA
Splicing
Mature mRNA
Reverse Transcription
cDNA
Basic Concepts in
Modern Genetic Epidemiology

Allele: Alternative forms of a gene or DNA
sequence at a specific chromosomal location

Allelic association: Any significant association
between specific alleles at two or more
neighboring loci

Allelic heterogeneity: Different mutations at the
same locus cause the same phenotype
Basic Concepts in
Modern Genetic Epidemiology
 Locus: The physical location of a gene
 Locus
heterogeneity: A phenotype may
be caused by mutations at more than one
gene locus
Basic Concepts in
Modern Genetic Epidemiology
 Mutation: A change
in the DNA
 Polymorphism: A locus
with more than
one allele, each of which occurs with at
least 1% frequency
Point Mutations
 Base substitutions
» Change in a single nucleotide
» Transitions: changes from purine-purine or
pyrimidine-pyrimidine.
– Examples: AG, TC
» Transversions: changes from purine to
pyrimidine or vice versa.
– Examples: AT, GC
Point Mutations

Synonymous substitutions: A substitution
which replaces one codon by another without
changing the amino acid that is specified
=silent mutation

Non-synonymous substitutions: A substitution
which replaces one codon by another with changing
the amino acid that is specified
=missense mutation
Mutations
 Deletions
- small and large
» Example: insulin receptor gene
» TTCAAGAGATgATTCAGATGG (small)
» Entire gene (large)
Mutations
 Insertions
» Example: ACE Gene
– Intron 16 D/I (289-bp Alu-I repeat sequence)
 Inversions
» Example: IDS Gene
– Inversions of Exons 8 and 9
Point Mutations




Missense mutation: A codon change can occur, such
that a new amino acid is coded for.
Nonsense mutation: A stop codon can be created,
causing termination of synthesis.
Silent mutation: If no change in product is observed,
because of the redundancy of the genetic code.
Frameshift Mutation: Change in reading frame,
usually by deletion or insertion of one or more
nucleotides.
Point Mutations

Splicing mutation: Changes in the splice
donor/acceptor site or branch site that cause aberrant
splicing
» Example: Insulin receptor gene
– Intron4 AG  GG (splice acceptor site)

Regulatory mutation: Changes in promoter site
sequences that can affect the rate of transcription
» Example: IL1 alpha gene
– GGCAACA(CT)CATTGAAGGC (-889 relative to the
transcription initiation site)
Mitosis and Meiosis

Mitosis: A type of nuclear division that
results in two daughter cells identical to the
original cell

Meiosis: The process of two successive
nuclear divisions resulting in cell with 1/2
the genetic complement of the original cell
Hardy-Weinberg Equilibrium

Hardy and Weinberg discovered that for a
given population, under certain stable
conditions, gene frequencies tended to
remain constant
Hardy-Weinberg Equilibrium

Let p = freq. Of one allele (A)
Let q = freq. Of the alternative allele (a)

p + q =1

HWE predicts that proportion in the next generation
will be:
»p2 + 2pq + q2 =1, where
»p2, 2pq, q2 represent allele freq. of AA, Aa, and aa

Hardy-Weinberg Assumptions
 Population is definitely large
 Each genotype is equally likely to mate with
any other
 All genotypes produce viable offspring with
same frequency - have equal genetic fitness
 No mutation occurs
 No migration in or out of population occurs
Mendel’s First Law

The law of segregation

During gamete formation each member of the
allelic pair separates from the other member to
form the genetic constitution of the gamete
Mendel’s Second Law

The law of independent assortment

During gamete formation the segregation of the
alleles of one allelic pair is independent of the
segregation of the alleles of another allelic pair
Basic Concepts in
Modern Genetic Epidemiology
Autosomal Dominant Inheritance
X-Linked Inheritance
Autosomal Recessive Inheritance
Basic Concepts in
Gene Mapping
 Genetic
Linkage Map: Measures the
amount of recombination between two
loci; quantified by either recombination
fraction or centiMorgans
 Physical
Map: Quantifies the actual
amount of DNA, usually in base pairs,
between two loci
Genetic Map and Physical Map
Genetic Map (Distribution of Cross-Overs)
A
A
B
C
B
C
D
D
Physical Map (Number of DNA Base Pairs)
A-B:
Suppression of recombination
Genetic Distance Shorter than Physical Distance
B-C:
Increase of recombination
Genetic Distance Larger than Physical Distance
Basic Concepts in
Gene Mapping

Sequence-tagged site (STS): any piece of
DNA whose sequence is known and for
which a specific PCR assay has been
designed

Example:
» 273-bp STS (Genebank: G54567)
» TGACTCCAATGACCGTCTGTCTATTTCACTGTATCCAGGCCAGTCTCTTTGAAG
CTCTTTAAAAACATAATCCTTTAAGGTATATGAGAGGTCCTTAGAATTCAGATTG
GCTACCTAGTATGAGGTATAAAAACAGAGCATTAGGTATTTTTACTATCATCTCC
TAACCTAAAACAGGCAACCTTTAGGATTTACACTGAAAATAATTACATCAATTG
GCCCCAAAGGGACTGCTAGTTTTGTATTATATGCCAGATCTCAATAAATGCCAT
T
Basic Concepts in
Gene Mapping
Expressed sequence tag (EST): A short
sequence of a cDNA clone for which a PCR
assay is available
 Example:

187-bp cDNA (Genebank: AL110360)
» AAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAG
AGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATT
TGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACC
TGATTATACAGGCAAAAAAAAAAAAAAAAAA
Basic Concepts in
Gene Mapping

Recombination: The process during meiosis by
which homologous chromosomes exchange
material

Crossover: The physical process that results in
the exchange of genetic materials between two
paired chromosomes during a recombination
event

Recombination fraction: The frequency of
crossing over between two loci
Crossover
Basic Concepts in
Gene Mapping
 Marker: A polymorphic DNA or protein
sequence derived from a single
chromosomal location
 Primer: A short nucleic acid sequence
which specifically binds to a single strand of
a targeted nucleic acid sequence
Basic Concepts in
Modern Genetic Epidemiology
 Genotype:
The observed alleles at a
locus in an individual
 Haplotype: A series
of alleles found at
linked loci on a single chromosome
Basic Concepts in
Gene Mapping
 Heterozygous: The alleles at a genetic
locus are different from one another
» Example: Aa
 Homozygous: The alleles at a genetic
locus are identical
» Examples: AA and aa
Basic Concepts in
Gene Mapping

Single nucleotide polymorphism (SNP): a
substitution, deletion, or insertion of a single
nucleotide
» Examples: AG, AC

cSNP: A SNP that occurs in the coding
sequence of a gene
» Example: CTC (Leu)TTC (Phe)
Basic Concepts in
Gene Mapping

Microsatellite DNA: small array of tandem
repeats of a very simple sequence, often between
1-4 bp (often < 0.1 kb)
Example: A tetranucleotide repeat microsatellite
…GAAAGAAAGAAAGAAAGAAAGAAAGAAA...

Minisatellite DNA: An intermediate size array of
short tandemly repeated DNA sequences
Example: A minisatellite (Genebank: AF157691)
…(AGGGGGTGAGGGTGGGTGTGCTGG)n...
Basic Concepts in
Modern Genetic Epidemiology

Polymorphism Information Content: A
measure of marker informativeness that reflects the
fraction of matings in which a particular parent is
expected to be fully informative

Heterozygosity: The fraction of individuals that
are likely to be heterozygous at that locus
Basic Concepts in
Gene Mapping
 Identity
by descent (IBD): Two alleles are
IBD which it can be determined with
certainty that they have been inherited from
a common ancestor
 Identity
by state (IBS): Two alleles are
IBS when they share the same state
IBD and IBS
AB
CD
AB
AC
AC
AC
AB
AC
IBD sharing: 2
IBS sharing: 2
IBD sharing: 0
IBS sharing: 1
Basic Concepts in
Gene Mapping

Linkage: The tendency of genes or other
DNA sequences at specific loci to be
inherited together as a consequence of their
physical proximity on a single chromosome

Linkage Disequilibrium: Nonrandom
associations of alleles at linked loci
LOD Score
 L( pedigree |   x ) 
LOD  z ( x )  log 10 

 L( pedigree |   0.5) 
• a two-point LOD score defined by Morton (1955)
•L(pedigree|=x): the likelihood of observing a
particular configuration of a disease and a
marker locus in a family assuming a selected
range of  (0  0.5)
Basic Concepts in
Modern Genetic Epidemiology

Morgan: A unit of genetic distance
corresponding to a length of DNA which, on
average, undergoes one crossover per individual
chromatid strand
 centiMorgan (cM): A unit of genetic
distance equivalent to a 1% probability of
recombination during meiosis
Basic Concepts in
Modern Genetic Epidemiology
Aa
aa
Aa
aa
Bb
bb
Bb
bb
Phase Unknown
Aa
aa
Bb
bb
Phase Known
Basic Concepts in
Gene Mapping

Penetrance: The probability of expressing a
phenotype given a genotype

Phenocopy: A trait that appears to be
identical to a genetic trait but is caused by
non-genetic factors

Pleiotropy: One gene loading to many
different phenotypic expressions.
Basic Concepts in
Gene Mapping

Bacterial artificial chromosomes (BAC): A
recombinant plasmid which permits
propagation of very large inserts (up to 300kb)
in bacterial cells

Yeast artificial chromosomes (YAC): An
artificial chromosome produced by combining
large fragments of foreign DNA with small
sequence elements necessary for chromosome
function in yeast cells