* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA Profiling
DNA methylation wikipedia , lookup
Epigenetic clock wikipedia , lookup
Metagenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA sequencing wikipedia , lookup
DNA barcoding wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
DNA paternity testing wikipedia , lookup
Designer baby wikipedia , lookup
Human genome wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Primary transcript wikipedia , lookup
DNA polymerase wikipedia , lookup
Genomic library wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA profiling wikipedia , lookup
Microevolution wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Microsatellite wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Helitron (biology) wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA Profiling Chapter 7 DNA Profiling • use of molecular genetic methods to determine the exact genotype of a DNA sample to distinguish one human being from another – Crime scenes, missing persons, mass disasters, paternity testing, exonerate the innocent (Innocence Project), solve cold cases, resolve historical mysteries, etc. – Can link suspects to a scene or exclude them • ~ 3 billion bases in the human genetic blueprint • DNA sequences used for forensic typing are “anonymous” – greater than 99.5% do not vary among human beings – Small percentage of the human DNA sequence (<.5%) differs (polymorphic) – derived from regions of our chromosomes (also called loci) that do not control any known traits and have no known functions History of Forensic Analysis • • • First genetic evidence to be collected for investigative work involved the use of blood group typing 1985 – DNA Fingerprinting – has been the mainstay of forensic analysis for nearly 20 years – RFLP – restriction fragment length polymorphism 1983 (development)/1993 (Nobel Prize) – PCR (Polymerase Chain Reaction) – Utilize very small samples of DNA – Revolutionized research and forensic analysis • 1991 – STR Analysis (Short Tandem Repeats) – Shorter repeating bases than what was previously used – More easily recovered from limited quantity of DNA typically found in evidence CODIS • 1998 – FBI launched the National DNA Index System (NDIS) – Database of DNA profiles of individuals who were either arrested or were convicted of a serious crime – Used for establishing identity of unknown crime scene DNA • CODIS (Combined DNA Index System) – collects, analyzes, and communicates criminal DNA information – NDIS is now a part of CODIS – 2014: CODIS had 11.1 million offenders’ DNA profiles and 1.9 million arrestee DNA profiles; more than 257,000 hits assisting in more than 246,000 investigations DNA • • • No two individuals share the same DNA (with the exception of identical twins) Half from mom and half from dad! Exists in the nucleus of every cell in the body except red blood cells – Also inside mitochondria (mtDNA) • Contains genetic code for the production of proteins • all DNA found in human cells makes up the human genome – Cell can replicate its DNA and carry on all life functions using these proteins! – Only .5% of DNA (15 million nucleotides) determine the difference between individual people! • can be extracted from hair, blood, saliva, semen, bone, or other body tissue DNA Structure • DNA is a polymer made of repeating monomers – Nucleotides: contain a 5-carbon sugar, phosphate group, and nitrogenous base – four nitrogenous bases: Adenine (A), Thymine (T), Guanine (G), Cytosine (C) • Order of these bases makes up the genetic code that specifies what proteins a cell produces, when they are produced, and how much is produced – DNA of every organism on Earth is made of the same 4 bases! DNA Structure • James Watson & Francis Crick received the Nobel Prize (1953) – Described the structure of DNA as a double helix (twisted ladder) – Sides consist of alternating sugar and phosphate molecules – Steps (rungs) are made up of pairs of complementary base pairs • Approximately 6 billion base pairs in human body cells • A-T, C-G • Ex: one side of the ladder is CGTCTA…what would the other strand be? Chromosomes • DNA is wound around proteins (histones) and condensed during cell division into chromosomes – Anywhere from 50 - 500 million nucleotides make up a chromosome – 46 in each cell, 23 from mom and 23 from dad • Exception: sex cells! Formed in meiosis. – Homologous pairs: chromosomes containing same genes from mom and dad – 22 pairs of autosomes (chromosomes 122) and 1 pair of sex chromosomes (chromosome 23: X & Y) Chromosomes Human Karyotypes Genes & Alleles • Section of DNA on a chromosome that codes for a protein • Average around 3,000 base pairs, but can be composed of many thousands of base pairs • Humans have 30,000 genes in their 46 chromosomes – Human Genome Project: mapping the human genome, where genes are located, what proteins they code for • Locus (loci): location of a gene on the chromosome • Allele: alternative forms/versions of a gene – i.e. blood type: A allele, B allele, O allele – different combinations produce different blood types (remember…one from each parent) Exons & Introns • Coding regions are only 5% of DNA in human genome! – much of the genome is made up of noncoding sequences (95%) • Function is unclear; proposed that they may perform regulatory functions or act as genetic “on-andoff switches.” • Deleted after a cell transcribes the DNA into messenger RNA – Exons – genes, regions of DNA that are expressed as proteins – Introns – noncoding regions of DNA DNA Replication • Necessary for cell division! • Must have a high degree of specificity and accuracy – the enzymes involved use the information already contained in the existing strands to make new DNA copies – DNA is copied from a template • This is the basis for PCR technology! Evidence Collection • • Proper collection, documentation, storage, and processing of DNA must follow precise protocols in order to be accepted as reliable evidence in court PCR has allowed for trace samples of DNA to be amplified (copied) so that adequate amounts of DNA evidence are available for testing – Proper collection and avoiding contamination is still necessary! Will amplify contamination • Keep evidence dry & cool during transportation and storage – Moisture compromises DNA evidence because humidity encourages mold growth – Prolonged direct sunlight and warm conditions are also harmful Avoiding Contamination • • • • • • • • Wear disposable gloves (change them often) Disposable instruments Avoid touching the area where DNA may exist Avoid talking, sneezing, and coughing on evidence Avoid touching your face when collecting and packaging evidence Air-dry evidence thoroughly before packaging If wet evidence cannot be dried, it may be frozen, refrigerated, or placed in a paper bag Put evidence into new paper bags or envelopes Personal Identification • 1987 – Dr. Alec Jeffries (U. of Leicester, U.K.) conducted the first forensic personal identification of a suspect based on a technique he called DNA fingerprinting – We now call DNA Profiling or DNA Typing, and it has been improved utilizing newer technology • Polymorphisms are used to distinguish one person from another (regions in the DNA of high variability) – Located within the noncoding regions of DNA, consist of repeating base sequences of DNA that repeat one after the other (in tandem) – Number of polymorphisms differs among individuals and results in a different DNA profile (pattern) for each individual – 99.5% of all human DNA is same, so only need to examine that 0.5% region of variability instead of the entire DNA DNA Fingerprinting • • Examine regions of high variability within the noncoding regions of DNA to establish the identify of a person DNA is isolated and cut using restriction enzymes • • Act like molecular scissors and makes cuts at specific sequences of a base Sits on a DNA molecule and slides along the helix until it recognizes specific sequences of base pairs that signal the enzyme to stop sliding – • • • – then cuts or chemically separates the DNA molecule at that site (restriction site) • create fragments of DNA called restriction fragments • RLFP (Restriction Fragment Length Polymorphism) • Smaller pieces travel further in the gel • Creates a unique band pattern that can be used to identify a person Each person’s DNA is different, so each person's length and number of DNA restriction fragments differs Separated by size on a gel when an electric field is applied Radioactive probes bond to the highly variable regions PCR amplification – allows analysis of minute quantities of DNA in shorter time Gel Electrophoresis • • • • • • • • • Use agarose gel & electricity Separates DNA fragments by size (relative # of base pairs) DNA is loaded into an agarose gel slab, placed into a chamber filled with a conductive buffer solution Direct current is passed between wire electrodes at each end of the chamber DNA is negatively charged, so drawn toward positive pole (anode) when placed in an electric field Matrix of gel acts as a molecular sieve through which smaller DNA fragments can move more easily than larger ones Smaller fragments (fewer base pairs) move more quickly than larger ones (more base pairs) Smaller DNA fragments will travel farther than larger ones Fragments of the same size stay together and migrate in single bands of DNA (will be seen in the gel after DNA is stained) Gel Electrophoresis Making DNA visible • DNA is colorless, so fragments cannot be seen during electrophoresis • Loading buffer is added to the DNA samples – makes it easier to load the samples and monitor the progress of the DNA electrophoresis – dye fronts migrate toward the positive end of the gel, just like the DNA fragments Making DNA visible Reading the Gel • Lane 1: DNA size standards • Number from top left (so load right to left) • See if any suspects’ bands match those of the DNA found at the crime scene • DNA evidence places the suspect at the scene, but other evidence may be needed to prove him or her guilty • In actual DNA fingerprinting, larger segments of DNA are analyzed and many more bands and lanes are produced Reading the Gel Parental Identification Reading the Gel Reliability • • • • Two major factors affecting reliability: population genetics and genetic statistics Humans have thousands of RFLP loci or DNA segments that can be selected and used for fingerprinting analysis Can depend on demographic factors such as ethnicity or geographic isolation Humans only differ in about 1-5 bp in 1000 – – – • • Need to examine variable regions Some populations show much less variation in particular DNA segments than others Degree of variation will affect the statistical odds of more than one individual having the same Different populations show different patterns in their genotypes due to the contributions made to their individual gene pools over time Statistically, how many people in a population have the same pattern as that taken from a crime scene: 1 in 1,000,000? 1 in 10,000? Or 1 in 10? PCR • • • • • • • • 1983 – developed, Nobel Prize 1993 (Kary Mullis) Polymerase Chain Reaction – utilizes the mechanisms of the cell during DNA replication to amplify (copy) small samples of DNA Tremendous impact on biotechnology: gene mapping, cloning, DNA sequencing, gene detection, DNA profiling Prior to PCR, DNA analysis was cost prohibitive or sometimes impractical PCR produces exponentially large amounts of a specific piece of DNA from trace amounts of starting material (template) Template can be any form of double-stranded DNA and generates millions of copies of a desired DNA fragment Ability to amplify the precise sequence of DNA that a researcher wishes to study or manipulate Can then run these sequences using gel electrophoresis or other technology Short Tandem Repeats (STRs) • 1991 – new and improved method of analyzing variable regions of DNA – – – • Shorter repeating bases, consisting of fewer than 50 bases More easily recovered from often-degraded and limited quantities of DNA typically found in evidence Has replaced DNA fingerprinting in modern-day DNA profiling DNA sequences used in forensic DNA profiling are non-coding regions that contain segments of short tandem repeats – – Very short DNA sequences that are repeated in direct head-to-tail fashion Example (shows a locus known as TH01 actually used in forensic DNA profiling): the DNA sequence at this locus contains four repeats of TCAT …CCCTCATTCATTCATTCATTCA… • • For the TH01 STR locus, there are many alleles that differ from each other by the number of TCAT repeats present in the sequence Although more than 20 different alleles of TH01 have been discovered in people worldwide, each of us still has only 2 of these (from mom & dad!) 13 Core STRs • FBI uses 13 core STRs for identification of Americans • Sex chromosomes (X * Y) have a non-STR locus (AMEL) that is used to identify the DNA source as male or female samples examined at 13 different loci using genotyping software to interpret the results from products amplified by PCR More loci analyzed improves the power of discrimination of the testing • • – Notice TH01 is on chromosome 11 – D18S51 is one of the more highly variable core STR markers (repeats AGAA and varies from 7 repeats to 40 repeats) – ability of the typing to discriminate between different individuals 13 Core STRs STR Analysis • • Amplification of the copies present in the small amounts of evidentiary DNA by polymerase chain reaction (PCR) Using primers specific to the DNA sequences on either side of the STR, billions of copies of each of the 2 original alleles in any one person’s DNA type ore synthesized in the reaction – – – • • Copies contain the same number of STRs present in the original DNA copies and can be separated by size using agarose gel electrophoresis Comparison with size standards that correspond to the known sizes of the specific alleles, the sizes of the amplified copies can be determined One locus may be able to tell the difference between one out of 1,000 people, 2 1/10,000…the larger the number of loci typed, the more powerful the ability to discriminate Performed by automated machines and computers Commercial kits and analyzers are used that can amplify multiple STR markers simultaneously – – – Add fluorescent dyes to the PCR and identify different STR markers Signal recorded as peaks in a graphic display (electropherogram) STR alleles are identified by size and color on the graphic display Power of Discrimination Inheritance of STRs • Alleles for different traits are assorted independently as sex cells are developed during meiosis – Example: if mother inherits a repeat of 9 at a locus from one parent and a repeat of 12 at the same locus from the other parent, she will only pass one of these on in her egg to her offspring (½ of her eggs will have 9 repeats and ½ of her eggs will have 12); same for male (i.e. allele of 14 and an allele of 15) • • • Independent assortment provides four different allele combinations found in their offspring: (9,14), (9,15), (12,14), and (12,15) 2 of the same alleles for a particular STR (i.e. 5, 5) – homozygous 2 different alleles for a particular STR (i.e. 9, 14) heterozygous DNA STR Profiles • DNA profile usually includes the alleles for all 13 core STR loci plus the non-STR indicator for the sex chromosomes (AMEL) – The more loci used the greater the probability that the DNA profile came from the individual identified and not someone else STR Allele Frequencies • Allele frequency: calculation of how often a particular allele appears within a given population – Equals the number of times an allele is observed in a given population divided by the total alleles observed in the population – Differ among different populations (important that the data is taken from the correct population) • Calculations using STR allele frequencies are made to determine the probability that a random person in the population would have the same DNA profile as the suspect in a crime Y STR & mtDNA • Many STRs are being used besides the FBI’s core 13 • STRs located on the Y chromosome are used to trace ancestry through the male line • mitochondrial DNA is used to trace ancestry traced through the maternal line – mtDNA can be analyzed when nuclear DNA is not present or is degraded – No STRs, but has two noncoding base sequences that are variable regions • Both are class evidence because only link familial lines (paternal and maternal) Civil Liberty Concerns • There are concerns that civil liberties of innocent people are being threatened because of familial testing – Sometimes family members are tested to help with identification – People who have done nothing wrong but are related to criminal suspects can be investigated – Violation of the 4th amendment right that protects the individual from improper search and seizure? Romanovs • • • • Romanovs ruled Russia for 300 years 1918 – Bolsheviks captured, held hostage, and ultimately brutally executed the tsar and his family and secretly buried them in mass graves in Siberia 1970s, mass grave located containing the remains of nine people believed to be some of the Romanovs and their servants – – – Grave kept a secret until 1991, after fall of Soviet Union Exhumed in 1991, used STR analysis to identify the skeletal remains Children, Alexei and Princess Anastasia, were not in grave – – 2006 – second gravesite discovered More advanced methods of autosomal STR, Y-STR, and DNA analysis, along with vast improvements in computers, identified the children in the gravesite mtDNA analysis confirmed that Anna Anderson was not Anastasia Anna Anderson had many convinced that she was Anastasia (for more than 60 years) – DNA & Forensics: A Timeline 1983 – Dr. Kary Mullins invents PCR 1985 – Dr. Alec Jeffries develops DNA fingerprinting 1986 – Automated DNA sequencing developed 1988 – DNA casework begins, first American case to convict a suspect based on DNA evidence 1990 – Population statistics used with DNA fingerprinting; Human Genome Project begins 1991 – STR first described 1992 – The Innocence Project 1993 – First DNA exoneration, First STR kit available; DNA sex typing developed 1994 – DNA Identification Act of 1994 – establishment of national DNA database 1995 – OJ Simpson murder trial raises public awareness of DNA and importance of proper crime-scene processing 1996 – FBI starts mtDNA testing DNA & Forensics: A Timeline 1997 – 13 Core STR loci and Y-chromosome STR loci defined 1998 – FBI initiates National Combined DNA Index System (CODIS) 2000 – FBI develops National Missing Person DNA Database (NMPDD) to help identify missing persons using STR, Y-STR, and mtDNA 2002 – Improved STR analysis of 16 loci in an easy-to-read graphic display 2003 – U.S. DNA database exceeds 1 million convicted offender profiles; Human Genome Project completed. 2004 – Justice for All Act grants federal inmates the right to DNA testing 2007 - James Watson and Craig Venter release fully sequenced genomes 2013 - Supreme Court decision: Police can with probable cause take a DNA swab from an arrestee for serious offense 2014 – National Commission on Forensic Science appointed to standardize and set requirements for certification and training Kirk Bloodsworth • 1984 – 9 year old girl found raped and beaten in wooded area near her home • Kirk Bloodsworth was convicted of the crime, despite alibi and evidence supporting the alibi • Case was retried due to legal technicality and he was again found guilty in 1986 • Sentenced to 3 life terms • 1992 – semen sample from victim’s clothing analyzed using PCR and DNA fingerprinting – DNA evidence was not consistent with Bloodworth’s DNA and he was pardoned after 9 years in prison Steven Avery • 1985 – Penny Ann Beernsten was sexually assaulted while on a run • Picked Steven Avery out of a photo line up, and hair recovered from Avery’s shirt was consistent with Beernsten’s hair • Avery had 16 alibi witnesses • Convicted almost exclusively on eyewitness account • 1995 – DNA testing was unable to eliminate Avery (from under Beernsten’s fingernails) • 2002 - tested hairs recovered from Beernsten and they were linked to Gregory Allen, convicted felon who resembled Avery Grim Sleeper • LA serial killer for more than 25 years • 2008 – CA authorized familial searching of the DNA database – 2010 – markers on the Y chromosome of the suspect of a crime’s DNA were consistent with those on the Y chromosome of the Grim Sleeper and provided a lead – Police officer posed as a waiter at a pizza restaurant and obtained DNA evidence from the suspect’s father, leading to the father’s arrest
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            