Download DNA Profiling

DNA Profiling
Chapter 7
DNA Profiling
•
use of molecular genetic methods to determine the
exact genotype of a DNA sample to distinguish one
human being from another
– Crime scenes, missing persons, mass disasters, paternity
testing, exonerate the innocent (Innocence Project), solve
cold cases, resolve historical mysteries, etc.
– Can link suspects to a scene or exclude them
•
~ 3 billion bases in the human genetic blueprint
•
DNA sequences used for forensic typing are
“anonymous”
– greater than 99.5% do not vary among human beings
– Small percentage of the human DNA sequence (<.5%) differs
(polymorphic)
– derived from regions of our chromosomes (also called loci)
that do not control any known traits and have no known
functions
History of Forensic
Analysis
•
•
•
First genetic evidence to be collected for investigative
work involved the use of blood group typing
1985 – DNA Fingerprinting
– has been the mainstay of forensic analysis for nearly 20 years
– RFLP – restriction fragment length polymorphism
1983 (development)/1993 (Nobel Prize) – PCR
(Polymerase Chain Reaction)
– Utilize very small samples of DNA
– Revolutionized research and forensic analysis
•
1991 – STR Analysis (Short Tandem Repeats)
– Shorter repeating bases than what was previously used
– More easily recovered from limited quantity of DNA typically
found in evidence
CODIS
• 1998 – FBI launched the National DNA Index
System (NDIS)
– Database of DNA profiles of individuals who were
either arrested or were convicted of a serious crime
– Used for establishing identity of unknown crime
scene DNA
• CODIS (Combined DNA Index System) – collects,
analyzes, and communicates criminal DNA
information
– NDIS is now a part of CODIS
– 2014: CODIS had 11.1 million offenders’ DNA
profiles and 1.9 million arrestee DNA profiles; more
than 257,000 hits assisting in more than 246,000
investigations
DNA
•
•
•
No two individuals share the same DNA (with the
exception of identical twins)
Half from mom and half from dad!
Exists in the nucleus of every cell in the body except
red blood cells
– Also inside mitochondria (mtDNA)
•
Contains genetic code for the production of proteins
•
all DNA found in human cells makes up the human
genome
– Cell can replicate its DNA and carry on all life functions using
these proteins!
– Only .5% of DNA (15 million nucleotides) determine the
difference between individual people!
•
can be extracted from hair, blood, saliva, semen,
bone, or other body tissue
DNA Structure
• DNA is a polymer made of repeating monomers
– Nucleotides: contain a 5-carbon sugar, phosphate
group, and nitrogenous base
– four nitrogenous bases: Adenine (A), Thymine (T),
Guanine (G), Cytosine (C)
• Order of these bases makes up the genetic code that
specifies what proteins a cell produces, when they are
produced, and how much is produced
– DNA of every organism on Earth is made
of the same 4 bases!
DNA Structure
• James Watson & Francis Crick received the
Nobel Prize (1953)
– Described the structure of DNA as a double
helix (twisted ladder)
– Sides consist of alternating sugar and
phosphate molecules
– Steps (rungs) are made up of pairs of
complementary base pairs
• Approximately 6 billion base pairs in human body
cells
• A-T, C-G
• Ex: one side of the ladder is CGTCTA…what would
the other strand be?
Chromosomes
• DNA is wound around proteins
(histones) and condensed during
cell division into chromosomes
– Anywhere from 50 - 500 million
nucleotides make up a chromosome
– 46 in each cell, 23 from mom and 23
from dad
• Exception: sex cells! Formed in meiosis.
– Homologous pairs: chromosomes
containing same genes from mom and
dad
– 22 pairs of autosomes (chromosomes 122) and 1 pair of sex chromosomes
(chromosome 23: X & Y)
Chromosomes
Human Karyotypes
Genes & Alleles
• Section of DNA on a chromosome that codes for
a protein
• Average around 3,000 base pairs, but can be
composed of many thousands of base pairs
• Humans have 30,000 genes in their 46
chromosomes
– Human Genome Project: mapping the human
genome, where genes are located, what proteins
they code for
• Locus (loci): location of a gene on the
chromosome
• Allele: alternative forms/versions of a gene
– i.e. blood type: A allele, B allele, O allele – different
combinations produce different blood types
(remember…one from each parent)
Exons & Introns
• Coding regions are only 5% of
DNA in human genome!
– much of the genome is made up
of noncoding sequences (95%)
• Function is unclear; proposed that
they may perform regulatory
functions or act as genetic “on-andoff switches.”
• Deleted after a cell transcribes the
DNA into messenger RNA
– Exons – genes, regions of DNA that
are expressed as proteins
– Introns – noncoding regions of
DNA
DNA Replication
• Necessary for cell division!
• Must have a high degree of
specificity and accuracy
– the enzymes involved use
the information already
contained in the existing
strands to make new DNA
copies
– DNA is copied from a
template
• This is the basis for PCR
technology!
Evidence Collection
•
•
Proper collection, documentation, storage, and
processing of DNA must follow precise protocols in
order to be accepted as reliable evidence in court
PCR has allowed for trace samples of DNA to be
amplified (copied) so that adequate amounts of DNA
evidence are available for testing
– Proper collection and avoiding contamination is still
necessary! Will amplify contamination
•
Keep evidence dry & cool during transportation and
storage
– Moisture compromises DNA evidence because humidity
encourages mold growth
– Prolonged direct sunlight and warm conditions are also
harmful
Avoiding
Contamination
•
•
•
•
•
•
•
•
Wear disposable gloves (change them often)
Disposable instruments
Avoid touching the area where DNA may exist
Avoid talking, sneezing, and coughing on
evidence
Avoid touching your face when collecting and
packaging evidence
Air-dry evidence thoroughly before packaging
If wet evidence cannot be dried, it may be
frozen, refrigerated, or placed in a paper bag
Put evidence into new paper bags or envelopes
Personal Identification
•
1987 – Dr. Alec Jeffries (U. of Leicester, U.K.) conducted
the first forensic personal identification of a suspect
based on a technique he called DNA fingerprinting
– We now call DNA Profiling or DNA Typing, and it has been
improved utilizing newer technology
•
Polymorphisms are used to distinguish one person from
another (regions in the DNA of high variability)
– Located within the noncoding regions of DNA, consist of
repeating base sequences of DNA that repeat one after the
other (in tandem)
– Number of polymorphisms differs among individuals and
results in a different DNA profile (pattern) for each individual
– 99.5% of all human DNA is same, so only need to examine
that 0.5% region of variability instead of the entire DNA
DNA Fingerprinting
•
•
Examine regions of high variability within the noncoding regions of
DNA to establish the identify of a person
DNA is isolated and cut using restriction enzymes
•
•
Act like molecular scissors and makes cuts at specific sequences of a
base
Sits on a DNA molecule and slides along the helix until it recognizes
specific sequences of base pairs that signal the enzyme to stop sliding
–
•
•
•
–
then cuts or chemically separates the DNA molecule at that site (restriction
site)
•
create fragments of DNA called restriction fragments
•
RLFP (Restriction Fragment Length Polymorphism)
•
Smaller pieces travel further in the gel
•
Creates a unique band pattern that can be used to identify a person
Each person’s DNA is different, so each person's length and
number of DNA restriction fragments differs
Separated by size on a gel when an electric field is applied
Radioactive probes bond to the highly variable regions
PCR amplification – allows analysis of minute quantities of DNA in
shorter time
Gel Electrophoresis
•
•
•
•
•
•
•
•
•
Use agarose gel & electricity
Separates DNA fragments by size (relative # of base pairs)
DNA is loaded into an agarose gel slab, placed into a chamber
filled with a conductive buffer solution
Direct current is passed between wire electrodes at each end of
the chamber
DNA is negatively charged, so drawn toward positive pole
(anode) when placed in an electric field
Matrix of gel acts as a molecular sieve through which smaller DNA
fragments can move more easily than larger ones
Smaller fragments (fewer base pairs) move more quickly than
larger ones (more base pairs)
Smaller DNA fragments will travel farther than larger ones
Fragments of the same size stay together and migrate in single
bands of DNA (will be seen in the gel after DNA is stained)
Gel Electrophoresis
Making DNA visible
• DNA is colorless, so fragments cannot
be seen during electrophoresis
• Loading buffer is added to the DNA
samples
– makes it easier to load the samples and
monitor the progress of the DNA
electrophoresis
– dye fronts migrate toward the positive
end of the gel, just like the DNA fragments
Making DNA visible
Reading the Gel
• Lane 1: DNA size standards
• Number from top left (so load right to left)
• See if any suspects’ bands match those of
the DNA found at the crime scene
• DNA evidence places the suspect at the
scene, but other evidence may be needed
to prove him or her guilty
• In actual DNA fingerprinting, larger segments
of DNA are analyzed and many more bands
and lanes are produced
Reading the Gel
Parental Identification
Reading the Gel
Reliability
•
•
•
•
Two major factors affecting reliability: population genetics and
genetic statistics
Humans have thousands of RFLP loci or DNA segments that can
be selected and used for fingerprinting analysis
Can depend on demographic factors such as ethnicity or
geographic isolation
Humans only differ in about 1-5 bp in 1000
–
–
–
•
•
Need to examine variable regions
Some populations show much less variation in particular DNA segments
than others
Degree of variation will affect the statistical odds of more than one
individual having the same
Different populations show different patterns in their genotypes
due to the contributions made to their individual gene pools over
time
Statistically, how many people in a population have the same
pattern as that taken from a crime scene: 1 in 1,000,000? 1 in
10,000? Or 1 in 10?
PCR
•
•
•
•
•
•
•
•
1983 – developed, Nobel Prize 1993 (Kary Mullis)
Polymerase Chain Reaction – utilizes the mechanisms of
the cell during DNA replication to amplify (copy) small
samples of DNA
Tremendous impact on biotechnology: gene mapping,
cloning, DNA sequencing, gene detection, DNA profiling
Prior to PCR, DNA analysis was cost prohibitive or
sometimes impractical
PCR produces exponentially large amounts of a specific
piece of DNA from trace amounts of starting material
(template)
Template can be any form of double-stranded DNA and
generates millions of copies of a desired DNA fragment
Ability to amplify the precise sequence of DNA that a
researcher wishes to study or manipulate
Can then run these sequences using gel electrophoresis
or other technology
Short Tandem Repeats
(STRs)
•
1991 – new and improved method of analyzing variable regions of
DNA
–
–
–
•
Shorter repeating bases, consisting of fewer than 50 bases
More easily recovered from often-degraded and limited quantities of DNA
typically found in evidence
Has replaced DNA fingerprinting in modern-day DNA profiling
DNA sequences used in forensic DNA profiling are non-coding regions
that contain segments of short tandem repeats
–
–
Very short DNA sequences that are repeated in direct head-to-tail fashion
Example (shows a locus known as TH01 actually used in forensic DNA
profiling): the DNA sequence at this locus contains four repeats of TCAT
…CCCTCATTCATTCATTCATTCA…
•
•
For the TH01 STR locus, there are many alleles that differ from each other by the
number of TCAT repeats present in the sequence
Although more than 20 different alleles of TH01 have been discovered in people
worldwide, each of us still has only 2 of these (from mom & dad!)
13 Core STRs
•
FBI uses 13 core STRs for identification of Americans
•
Sex chromosomes (X * Y) have a non-STR locus (AMEL)
that is used to identify the DNA source as male or
female
samples examined at 13 different loci using genotyping
software to interpret the results from products amplified
by PCR
More loci analyzed improves the power of
discrimination of the testing
•
•
– Notice TH01 is on chromosome 11
– D18S51 is one of the more highly variable core STR markers
(repeats AGAA and varies from 7 repeats to 40 repeats)
– ability of the typing to discriminate between different
individuals
13 Core STRs
STR Analysis
•
•
Amplification of the copies present in the small amounts of
evidentiary DNA by polymerase chain reaction (PCR)
Using primers specific to the DNA sequences on either side of the
STR, billions of copies of each of the 2 original alleles in any one
person’s DNA type ore synthesized in the reaction
–
–
–
•
•
Copies contain the same number of STRs present in the original DNA
copies and can be separated by size using agarose gel electrophoresis
Comparison with size standards that correspond to the known sizes of
the specific alleles, the sizes of the amplified copies can be
determined
One locus may be able to tell the difference between one out of 1,000
people, 2 1/10,000…the larger the number of loci typed, the more
powerful the ability to discriminate
Performed by automated machines and computers
Commercial kits and analyzers are used that can amplify multiple
STR markers simultaneously
–
–
–
Add fluorescent dyes to the PCR and identify different STR markers
Signal recorded as peaks in a graphic display (electropherogram)
STR alleles are identified by size and color on the graphic display
Power of
Discrimination
Inheritance of STRs
•
Alleles for different traits are assorted independently as
sex cells are developed during meiosis
– Example: if mother inherits a repeat of 9 at a locus from one
parent and a repeat of 12 at the same locus from the other
parent, she will only pass one of these on in her egg to her
offspring (½ of her eggs will have 9 repeats and ½ of her eggs
will have 12); same for male (i.e. allele of 14 and an allele of
15)
•
•
•
Independent assortment provides four different allele
combinations found in their offspring: (9,14), (9,15), (12,14), and
(12,15)
2 of the same alleles for a particular STR (i.e. 5, 5) –
homozygous
2 different alleles for a particular STR (i.e. 9, 14) heterozygous
DNA STR Profiles
• DNA profile usually includes the
alleles for all 13 core STR loci plus
the non-STR indicator for the sex
chromosomes (AMEL)
– The more loci used the greater the
probability that the DNA profile
came from the individual identified
and not someone else
STR Allele Frequencies
• Allele frequency: calculation of how often a
particular allele appears within a given
population
– Equals the number of times an allele is observed in
a given population divided by the total alleles
observed in the population
– Differ among different populations (important that
the data is taken from the correct population)
• Calculations using STR allele frequencies are
made to determine the probability that a
random person in the population would have the
same DNA profile as the suspect in a crime
Y STR & mtDNA
• Many STRs are being used besides the FBI’s
core 13
• STRs located on the Y chromosome are used
to trace ancestry through the male line
• mitochondrial DNA is used to trace ancestry
traced through the maternal line
– mtDNA can be analyzed when nuclear DNA is
not present or is degraded
– No STRs, but has two noncoding base
sequences that are variable regions
• Both are class evidence because only link
familial lines (paternal and maternal)
Civil Liberty Concerns
• There are concerns that civil liberties of
innocent people are being threatened
because of familial testing
– Sometimes family members are tested to
help with identification
– People who have done nothing wrong
but are related to criminal suspects can
be investigated
– Violation of the 4th amendment right that
protects the individual from improper
search and seizure?
Romanovs
•
•
•
•
Romanovs ruled Russia for 300 years
1918 – Bolsheviks captured, held hostage, and ultimately brutally
executed the tsar and his family and secretly buried them in mass
graves in Siberia
1970s, mass grave located containing the remains of nine people
believed to be some of the Romanovs and their servants
–
–
–
Grave kept a secret until 1991, after fall of Soviet Union
Exhumed in 1991, used STR analysis to identify the skeletal remains
Children, Alexei and Princess Anastasia, were not in grave
–
–
2006 – second gravesite discovered
More advanced methods of autosomal STR, Y-STR, and DNA analysis,
along with vast improvements in computers, identified the children in
the gravesite
mtDNA analysis confirmed that Anna Anderson was not Anastasia
Anna Anderson had many convinced that she was Anastasia (for
more than 60 years)
–
DNA & Forensics:
A Timeline
1983 – Dr. Kary Mullins invents PCR
1985 – Dr. Alec Jeffries develops DNA fingerprinting
1986 – Automated DNA sequencing developed
1988 – DNA casework begins, first American case to convict a
suspect based on DNA evidence
1990 – Population statistics used with DNA fingerprinting; Human
Genome Project begins
1991 – STR first described
1992 – The Innocence Project
1993 – First DNA exoneration, First STR kit available; DNA sex typing
developed
1994 – DNA Identification Act of 1994 – establishment of national DNA
database
1995 – OJ Simpson murder trial raises public awareness of DNA and
importance of proper crime-scene processing
1996 – FBI starts mtDNA testing
DNA & Forensics:
A Timeline
1997 – 13 Core STR loci and Y-chromosome STR loci defined
1998 – FBI initiates National Combined DNA Index System (CODIS)
2000 – FBI develops National Missing Person DNA Database (NMPDD)
to help identify missing persons using STR, Y-STR, and mtDNA
2002 – Improved STR analysis of 16 loci in an easy-to-read graphic
display
2003 – U.S. DNA database exceeds 1 million convicted offender
profiles; Human Genome Project completed.
2004 – Justice for All Act grants federal inmates the right to DNA
testing
2007 - James Watson and Craig Venter release fully sequenced
genomes
2013 - Supreme Court decision: Police can with probable cause take
a DNA swab from an arrestee for serious offense
2014 – National Commission on Forensic Science appointed to
standardize and set requirements for certification and training
Kirk Bloodsworth
• 1984 – 9 year old girl found raped and beaten in
wooded area near her home
• Kirk Bloodsworth was convicted of the crime,
despite alibi and evidence supporting the alibi
• Case was retried due to legal technicality and he
was again found guilty in 1986
• Sentenced to 3 life terms
• 1992 – semen sample from victim’s clothing
analyzed using PCR and DNA fingerprinting
– DNA evidence was not consistent with
Bloodworth’s DNA and he was pardoned after 9
years in prison
Steven Avery
• 1985 – Penny Ann Beernsten was sexually
assaulted while on a run
• Picked Steven Avery out of a photo line up, and
hair recovered from Avery’s shirt was consistent
with Beernsten’s hair
• Avery had 16 alibi witnesses
• Convicted almost exclusively on eyewitness
account
• 1995 – DNA testing was unable to eliminate Avery
(from under Beernsten’s fingernails)
• 2002 - tested hairs recovered from Beernsten
and they were linked to Gregory Allen, convicted
felon who resembled Avery
Grim Sleeper
• LA serial killer for more than 25 years
• 2008 – CA authorized familial searching of
the DNA database
– 2010 – markers on the Y chromosome of the
suspect of a crime’s DNA were consistent with
those on the Y chromosome of the Grim
Sleeper and provided a lead
– Police officer posed as a waiter at a pizza
restaurant and obtained DNA evidence from
the suspect’s father, leading to the father’s
arrest