* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Project 1 Concepts in Biology Project 1 Development of a PCR
Molecular cloning wikipedia , lookup
Human genome wikipedia , lookup
Epigenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA paternity testing wikipedia , lookup
Primary transcript wikipedia , lookup
Neuronal ceroid lipofuscinosis wikipedia , lookup
Gene therapy wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genome evolution wikipedia , lookup
Human genetic variation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genetic code wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Population genetics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Genetic testing wikipedia , lookup
Oncogenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genetic engineering wikipedia , lookup
Microsatellite wikipedia , lookup
Public health genomics wikipedia , lookup
Helitron (biology) wikipedia , lookup
Genome editing wikipedia , lookup
Designer baby wikipedia , lookup
Frameshift mutation wikipedia , lookup
Genome (book) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Project 1 Concepts in Biology Project 1 Development of a PCR-based Genetic Test for Cystic Fibrosis Thirteen years after Roche launched the industry with a test for HIV load based on transcript abundance, molecular diagnostics is in full flower. A $3.3 billion market growing at 17 percent annually, the field includes assays for disease predisposition, screening, diagnosis, prognosis, monitoring, and predicting treatment efficacy, using markers ranging from SNPs to methylcytosine, messenger RNA to microRNA. Bringing digital power to traditional analog medicine, the field "is absolutely going to revolutionize health care," says Harry Glorikian, managing partner at Scientia Advisors. "I believe it with every fiber in my being." On December 22, 1989, the journal Science awarfed Taq polymerase (and PCR) its first “Molecule of the Year”. The ‘Taq PCR’ paper became for several years the most cited publication in biology. New genomic-era technologies such as NextGen sequencing have facilitated the identification of gene polymorphisms in the human genome. Such polymorphisms are being studied intensively in research laboratories around the world, in order to find association of specific polymorphisms with increased likelihood of developing disease. Knowing such associations allows biotech companies to develop diagnostic tests for specific genetic diseases. CKB Diagnostics, Inc, is a new biotech company, dedicated to the development of diagnostic tests for common genetic diseases. CKB Diagnostics has acquired rights to the development and commercialization of a diagnostic test for new mutations in the CFTR gene, which have been implicated in the development of cystic fibrosis (CF). Cystic Fibrosis is a genetic disease that affects the lungs, pancreas and other internal organs. You are a new member of the research team at CKB Diagnostics. This is your first job and you want to give the best impression to your supervisors. While your major in college was Biology and you have just completed a master’s degree in Molecular biology and Biotechnology, your passion is science writing. Your new job requires you to help with designing and developing the new genetic test as well as to prepare a patient pamphlet, explaining “What you need to know” about the new test. Disclaimer: all information in this case study is fictional 1 Project 1 Concepts in Biology Overview CKB Diagnostics has acquired the specific location and nature of four new CFTR gene mutations that were identified in cystic fibrosis patients and were absent in unaffected subjects. You will need to evaluate these mutations and based on their nature and location within the gene, decide which one would be more likely to associate with the disease. When you have picked the candidate mutation, you will set up to design primers for a PCR reaction that will detect the presence of this mutation in the DNA of patients. This PCR reaction will become the basis for the new commercially available genetic test. Your next task will be to describe this genetic test in a patient pamphlet. This pamphlet will include the following information: (1) What is cystic fibrosis? What causes it? (2) How is cystic fibrosis inherited? (3) What is a PCR-based DNA test? (4) What will you learn about your disease with the test? (5) How does the test may help your treatment? (6) Factors that could affect test results. These pamphlets tend to run ~3-4 slides not including cover, table of contents and bibliography. Completion of the pamphlet will require outside research, therefore sources should be cited as appropriate and a bibliography included at the end. Schedule and basic description of Project Parts Part 1 – Due week of 2/20 (5 points) Read background information and answer questions. Printed copy due in recitation on 2/23 or 2/24. Part 2 – Due week of 2/27 (5 points) Perform DNA analysis and answer questions. Printed copy due in recitation on 3/2 or 3/3. Part 3 – Due week of 3/6 (5 points) Design a PCR-based genetic test. Printed copy due in recitation on 3/9 or 3/10. Part 4 – Due week of 3/20 (25 points) Patient pamphlet, uploaded on Moodle by 3/24, 11:59pm. 2 Project 1 Concepts in Biology PART 1 Goals: Understand disease genes, dominant and recessive inheritance, expressivity of mutations. How Do Genes Work? Genes are often called the blueprint for life, because they tell each of your cells what to do and when to do it: be a muscle, make bone, carry nerve signals, and so on. And how do genes orchestrate all this? They make proteins. In fact, each gene is really just a recipe for a making a certain protein. And why are proteins important? Well, for starters, you are made of proteins. 50% of the dry weight of a cell is protein of one form or another. Meanwhile, proteins also do all of the heavy lifting in your body: digestion, circulation, immunity, communication between cells, motion-all are made possible by one or more of the estimated 100,000 different proteins that your body makes. But the genes in your DNA don't make protein directly. Instead, special proteins called enzymes read and copy (or "transcribe") the DNA code. The segment of DNA to be transcribed gets "unzipped" by an enzyme, which uses the DNA as a template to build a single-stranded molecule of RNA. Like DNA, RNA is a long strand of nucleotides. This transcribed RNA is called messenger RNA, or mRNA for short, because it leaves the nucleus and travels out into the cytoplasm of the cell. There, protein factories called ribosomes translate the mRNA code and use it to make the protein specified in the DNA recipe. If all this sounds confusing, just remember: DNA is used to make RNA, then RNA is used to make proteins-and proteins run the show. "Junk" DNA Scientists first studying DNA sequences were surprised to find that less than 2% of human DNA codes for proteins. If 98% of our genetic information (or "genome") isn't coding for protein, what is it for? At first it wasn't clear, and some termed this non-coding DNA "junk DNA." But as more research is done, we are beginning to learn more about the DNA between the genes-intergenic DNA. Intergenic DNA seems to play a key role in regulation, that is, controlling which genes are turned "on" or "off" at any given time. For example, some intergenic sequences code for RNA that directly causes and controls reactions in a cell, a job that scientists originally thought only proteins could do. Intergenic DNA is also thought to be responsible for "alternative splicing," a kind of mix-andmatch process whereby several different proteins can be made from one gene. In short, it now seems that much of the interest and complexity in the human genome lies in the stuff between the genes... so don't call it junk. A gene is a distinct stretch of DNA that determines something about who you are. Genes vary in size, from just a few thousand pairs of nucleotides (or "base pairs") to over two million base pairs. 3 DNA is a twisted double strand of nucleotides and a phosphate backbone. Project 1 Concepts in Biology Mutations and Disease DNA is constantly subject to mutations, accidental changes in its code. Mutations can lead to missing or malformed proteins, and that can lead to disease. We all start out our lives with some mutations. These mutations inherited from your parents are called germ-line mutations. However, you can also acquire mutations during your lifetime. Some mutations happen during cell division, when DNA gets duplicated. Still other mutations are caused when DNA gets damaged by environmental factors, including UV radiation, chemicals, and viruses. Few mutations are bad for you. In fact, some mutations can be beneficial. Over time, genetic mutations create genetic diversity, which keeps populations healthy. Many mutations have no effect at all. These are called silent mutations. But the mutations we hear about most often are the ones that cause disease. Some well-known inherited genetic disorders include cystic fibrosis, sickle cell anemia, Tay-Sachs disease, phenylketonuria and color- blindness, among many others. All of these disorders are caused by the mutation of a single gene. Most inherited genetic diseases are recessive, which means that a person must inherit two copies of the mutated gene to inherit a disorder. This is one reason that marriage between close relatives is discouraged; two genetically similar adults are more likely to give a child two copies of a defective gene. Diseases caused by just one copy of a defective gene, such as Huntington's disease, are rare. Thanks to natural selection, these dominant genetic diseases tend to get weeded out of populations over time, because afflicted carriers are more likely to die before reproducing. Scientists estimate that every one of us has between 5 and 10 potentially deadly mutations in our genes- the good news is that because there's usually only one copy of the bad gene, these diseases don't manifest. Cancer usually results from a series of mutations within a single cell. Often, a faulty, damaged, or missing p53 gene is to blame. The p53 gene makes a protein that stops mutated cells from dividing. Without this protein, cells divide unchecked and become tumors. Stanford at The Tech Understanding Genetics http://genetics.thetech.org/about-genetics/mutations-anddisease Read: What is cystic fibrosis? http://www.yourgenesyourhealth.org/cf/whatisit.htm Reduced penetrance and variable expressivity 4 Sickled blood cells (left) and normal blood cells. https://ghr.nlm.nih.gov/primer/inheritance/penetranceexpressivity Project 1 Concepts in Biology Part 1 Assignment (5 points) P Answer the following questions in a sentence or two for each part of the question. You aren’t graded by length of the answer, so be direct. We expect you to write in complete sentences, with proper grammar and punctuation. Explain the answers in your own words - DO NOT directly quote your sources. For each question, include a list of all the sources you used to research that question. If you were writing formally (like in the final part of this Project), you would need to follow the citation formats we discussed in class, but for this assignment, you do NOT need to indicate which information came from which source and citation format is not important (a website name and its URL is sufficient). Bring printed copy in recitation. 1. 2. 3. 4. 5. Doallgeneticmutationscausediseasesordisorders?Whyorwhynot? Which gene is mutated in cystic fibrosis? What chromosome is it located on? Whywouldprospectiveparentswanttobetestedforcysticfibrosismutations? Whatiscalledpenetranceingeneticdiseases? PART 2 Goals: Describe features in a DNA sequence that contains a gene. Evaluate different types of mutations for their potential to cause disease. Case study Four new mutations in the gene CFTR have been associated with a higher risk of developing cystic fibrosis. Three of the mutations are single base changes that map in the transcribed region of the gene, whereas the fourth mutation is a small deletion of 7 base-pairs that maps in the upstream non-transcribed region of the gene (mutations are marked with a green box). The sequence below represents the part of the sequence of the sense strand of CFTR (also called coding or non-template strand). Various features of this sequence are indicated on the sequence as well (+1, AUG, introns, stop codon, polyA signal, location of mutations). Below the DNA sequence there is an explanation of some of these features: CTGAGAAGC....... Transcribed sequence (in red type) AATTAAGAT...... Un-transcribed sequence (in black type) GCCAACTTC........ intron sequence The mark the identified mutations The mark the start and stop codon and polyA signal rinted copy due in recitation on 2/23 or 2/24. What is a gene composed of? Where do genes reside in the cell? What do genes produce? AATC... green boxes ATG magenta boxes 5 Project 1 Part of the CFTR gene sequence NOTE – make sure you print or view this page in color! 5’ GATGCCGTGCTCCAGGCACAATCTCTTCCAGAACTCGAAACCAACTG AATGGAGTGATCTCGATCAAGCCGGAGCTTCTCTTAACTTCGATTTCGAC GTGAAGAACTTACTTTGATTGCCACATTGGCCCAATTGAAGGGTTATAAT CTCGCTGGGCATTTTGCTCGAATTGCAGTTTAGTTAATTTCGCTTCTTTC TCAGTAAATAATAACTGTGCATCGAAGGCCAACTGGAGATGGAAGTGGAA GTCATTAATATCGATATACAAGAAGTACAATACAACAGTAAGTTATTACC TATTTTTCTTTACTAATCTTTATGATTTATTTAATGTTATTGGACTTATA GAAAATACTTAGAATTAAGATTTGATCCATTTTTTTTTTAAATATTTAGG TTCAAATAAATTAGCCATAGTTATATATTTTTTATGTTTTCATTTACATA AAACATTAACTGTTATTTTTTTAAATTTAAAGGACTAGCTTTTTCAATTG TACAGCACACCCTGTGGCTGCGAGTAACGGTTCTCGGGAGTCGTTATTTT +1 CTGAGAAGCGCGCAACGTGCACACTGGCAGGCTGATTGAAAAAA5T0TCGTT GCAAATGTTTATGTACAAATATTGAATAAAAAATAAAAATGCTGCGGCAG GAGAACTTGGCAGCCAACTTCTGCGGTCTCCTGGCCAGCCAGGGCTATAA AGGTGAGTTCGTATTTCGCCAATTTACTCCGAGCCTCATGGATGTCCGTA AAAATCGCAGAGAAGGCAAACGAGTGGCGCATTTTGGGCCAGGAACAGGA TGGATCTCTGCTCACGTCCTCGATATTCGAGTACGCGGACGAGGATCAGC GCAAGGAGACGTGCATTGGCCACTTTCACGCCACCAAGAAGCAGCTGCGA CTCCTTTGGACCCTCGACAATTGCCGTGAGATCGTCCAGGCAACGATTAA CAGCAGTGTCACATTGCTGTCCTTCGTGGAGAAAACTGAGGGCAAGCTCT ATCAGGCCTTTGTCGTGGAGGTAAGGAGCTCCGAAGGTGGCACGGCCACG CCCCTCAACTCGGAGCCCTCCAACCGCCAGATGATGACGCAGTTCCTGTG GCGCGTCGAGAGTGCCACGCGCACCTGCTGGCAGGACAAGCTACTGGTGC TCACCCACGAGGAATGTAGGTGTCATGTATATGTCATTATCCACCTCTAA CTCCCATGCTCGTACCTGTTTTTTCTAGCCATCAAGCAGTACAGCTGCGT GGTCAAGCAGAGCTCCACCACATGCTCGACTGGCGGAGGCGAGGGCAGCG CCTGGAGGCTAGACACCAGCATACTGACCTACGAAACGCTGGCCAGGAAC TTTAGCTGGGCCCAGTGGGATCCCGAGTGCCAGGCTCTTTATTACATTCA CTTGAAGCCGAAGGCCAAGAGCCTCAGTCTGCTGGACGAGAGGGAGGAGG CTGGCGAGCAGACAACTCCTACTTTAAGCCCCACGCTCTCCGCCTTTCAG TTTAACAATAAACAGCCAACGGAAACAGTGGTAGGTACTTAAAGATTAAA TGACTGTGCGTTAGGTCCTGTTCATTGGTACCCTTTATGAGTTAATTCAA ACCCACGGACATGCTAAGGGTTAATAAACAATCATATCGCTGTCTC 3’ Concepts in Biology Mutation 1 AATCTCT Deleted bases in some patients Mutation 2 G changed to A in some patients Mutation 3 C changed to T in some patients Mutation 4 G changed to C in some patients 6 Project 1 Concepts in Biology Part 2 Assignment (5 points) Due printed in recitation on 3/2 or 3/3 Answer the following questions in your own words, and bring printed copy in recitation. 1. In a short paragraph below, please describe how you think that each mutation identified on the previous page might affect the function of the CFTR gene. Hint: first examine if the mutation might affect the encoded protein or the regulation of expression of the gene. Describe the hypothetical mechanism of how each of these mutations might impair the function of the CFTR gene. 2. Based on your previous analysis, which mutation do you think is most likely to cause the disease? 3. If you decided to develop a genetic test for this disease, which human tissue would you use as a sample? PART 3 Goals: Learn how Polymerase Chain Reaction (PCR) can be used to detect known disease mutations, understand the basics of genetic testing and the benefits and limitations of genetic testing. Genetic Testing Have you ever had your genes tested? Probably not. DNA testing is still pretty limited, although it is becoming more and more common, especially for fetuses and newborns. Many prospective parents, especially those with a history of genetic disease in the family, seek genetic testing and counseling before having children. Genetic counselors can evaluate genetic tests and advise people of the risk of conceiving a child with recessive, inherited diseases like sickle cell anemia, Tay- Sachs disease, or cystic fibrosis. Genetic tests can be performed on fetuses by taking cell samples from the womb. The two techniques available are called amniocentesis and chorionic villi sampling. Down syndrome, a condition caused by having an extra chromosome, is tested for this way. After birth, most newborns are given a blood test for phenylketonuria, a genetic disease that can cause mental retardation if it goes undiagnosed. Not all genetic testing is focused on children. Testing is also done to match organ donors and recipients, to establish paternity or maternity, and in forensics, for identifying evidence from crime scenes. Testing can also help diagnose adult-onset inherited diseases, such as Huntington's disease. Genetic tests are now available for a range of cancers. These tests don't test for cancer directly, but instead indicate an increased likelihood of developing a cancer. Likelihood is far from certainty, and cancer may or may not develop, since it must be triggered by additional mutations. 7 Project 1 Concepts in Biology Meanwhile, many cancers develop in persons without so-called "cancer genes." For example, the two gene variants that have been linked with breast cancer, called BRCA1 and BRCA2, are involved in only 5% of breast cancer cases. The decision to be tested can be loaded. What if a gene test told you that age 40 or so, you would start to lose control of your muscles and live a shorter lifespan? This is the case in Huntington's disease, which has no cure. Perhaps you would rather not know, but the information might also guide your life decisions, such as when or whether to have children. Biochips Biochips, also called DNA arrays or microarrays, are a new technology that promises to speed and simplify a wide range of genetic tests. Each small glass slide or "chip" contains rows and rows of DNA probes, which test for the presence of a specific DNA sequence or mutation. If the mutation or sequence is present in the DNA being tested, a specific spot on the biochip will glow under special light. A biochip can test for thousands of mutations at once. Biochips could be the first step towards genetic ID cards. Imagine something like a credit card, except this card would carry all of your genetic information. Your doctors could use this DNA data to tailor your medical care and choose the right drugs and dosages. Stanford at The Tech Understanding Genetics http://genetics.thetech.org/about-genetics/genetic-testing PCR (Polymerase Chain Reaction) Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th century in molecular biology. Small amounts of the genetic material can now be amplified to be able to identify, manipulate DNA, detect infectious organisms, including the viruses that cause AIDS, hepatitis, tuberculosis, detect genetic variations, including mutations, in human genes and numerous other tasks. PCR involves the following three steps: Denaturation, Annealing and Extension. First, the genetic material is denatured, converting the double stranded DNA molecules to single strands. The primers are then annealed to the complementary regions of the single stranded molecules. In the third step, they are extended by the action of the DNA polymerase. All these steps are o o o temperature sensitive and the common choice of temperatures is 94 C, 60 C and 70 C respectively. Good primer design is essential for successful reactions. The important design considerations described below are a key to specific amplification with high yield. http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html Primer Length: It is generally accepted that the optimal length of PCR primers is 18-22 bp. This length is long enough for adequate specificity and short enough for primers to bind easily to the template at the annealing temperature. 2. GC Content: 1. The GC content (the number of G's and C's in the primer as a percentage of the total bases) of primer should be 40-60%. 8 Project 1 Concepts in Biology How does PCR work? PCR virtual lab http://learn.genetics.utah.edu/content/labs/pcr/ Watch this 3D-PCR animation: https://www.dnalc.org/view/15475-The-cycles-of-the-polymerase-chain-reaction-PCR-3Danimation-with- no-audio.html Genetic Testing – Risks and Limitations https://ghr.nlm.nih.gov/primer/testing/riskslimitations?_ga=1.156585977.316888639.148710201 6 Part 3 Assignment (5 points) Due printed in recitation on 3/9 or 3/10. Bring printed copy of your results in recitation. Include the provided sequence of the CFTR gene and mark clearly where your PCR-amplified region of the DNA lies. You can copy the sequence from Part 2 of the packet and paste it in a new word file. (A word document of the sequence can be found on moodle, for easier copying.) Design a genetic test based on a PCR reaction Your company has decided to develop a genetic test that will be used to diagnose the genotype of candidate CF patients and evaluate their risk of developing the disease. Due to cost considerations, this genetic test will consist of a single PCR-amplification reaction of genomic DNA. The amplified fragment should be around 200 base pairs. Although cellular DNA replication employs RNA primers, PCR reactions commonly use DNA primers, so design your primers to be made of DNA. In Part 2 of this case study, you selected a mutation that is most likely to cause the disease. Design two primers (one forward and one reverse) to be used in the PCR reaction that will amplify a fragment of approximately 200 base pairs that includes the mutation. You should aim to have the mutation approximately in the middle of the fragment, which means that you will amplify around 100 base pairs on each side of the mutation. Each primer should be 18 nucleotides long and should be at least 50% GCrich. Please write the sequence of your selected primers in the provided space (marking the 5’ and the 3’ direction of the DNA) and also underline the sequences that you picked in the genomic fragment that you are given. Also, add the % GC content of your primers in the provided space. Both primers should be written in the 5’ to 3’ direction. Forward primer: __ __ __ __ __ __ __ ______________________ Reverse primer: __ __ __ __ __ __ __ ______________________ %GC_____ %GC_____ 9 Project 1 Concepts in Biology PART 4 Goals: Design a patient information pamphlet for the new CF genetic test developed by CKB Diagnostics. Part 4 Assignment (25 points) Design a patient pamphlet - uploaded as a pdf file on Moodle by 3/24, 11:59pm Your pamphlet should explain the availability of the new genetic test for cystic fibrosis and should include answers to /description of all the topics listed below. You will upload your pamphlet on Moodle. A template for the pamphlet and a grading rubric will be provided on Moodle. Make sure you refer to the rubric when preparing your pamphlet! Make sure you cite your sources within the text, as discussed in lecture. Include the full citation for any sources that you used as references for this paper at the end of the document. Follow APA format for your citations. See the following website or links on moodle for help with that formatting: https://owl.english.purdue.edu/owl/resource/560/05/ New Genetic Test for Cystic Fibrosis - “What you need to know” o What is cystic fibrosis (CF)? What causes it? How is CF inherited? o Why some mutations might cause CF symptoms while other mutations might not? In which part of the CF gene is the mutation that is detected by the new genetic test located? How is this new mutation affecting the CF gene? o What is a PCR-based DNA test? Your company is planning to file a patent to protect the use of their genetic test. The US patent office requires submission of the sequence of the primers that are used in the new genetic test. Provide the sequence of the primers that your team designed, the information about the GC content and explain why these particular primers will have good specificity for the PCR reaction. Also describe which part of the CF gene you are amplifying and provide the sequence of the amplified fragment o What will you learn about CF with the test? o Factors that could affect test results Consider the diversity of patients relying on your pamphlet!