Download Project 1 Concepts in Biology Project 1 Development of a PCR

Project 1
Concepts in Biology
Project 1
Development of a PCR-based Genetic Test
for Cystic Fibrosis
Thirteen years after Roche launched the industry with a test for HIV load based on transcript abundance,
molecular diagnostics is in full flower. A $3.3 billion market growing at 17 percent annually, the field
includes assays for disease predisposition, screening, diagnosis, prognosis, monitoring, and predicting
treatment efficacy, using markers ranging from SNPs to methylcytosine, messenger RNA to microRNA.
Bringing digital power to traditional analog medicine, the field "is absolutely going to revolutionize health
care," says Harry Glorikian, managing partner at Scientia Advisors. "I believe it with every fiber in my
being."
On December 22, 1989, the journal Science awarfed Taq polymerase (and PCR) its first “Molecule of the
Year”. The ‘Taq PCR’ paper became for several years the most cited publication in biology.
New genomic-era technologies such as NextGen sequencing have facilitated the
identification of gene polymorphisms in the human genome. Such polymorphisms are
being studied intensively in research laboratories around the world, in order to find
association of specific polymorphisms with increased likelihood of developing disease.
Knowing such associations allows biotech companies to develop diagnostic tests for
specific genetic diseases.
CKB Diagnostics, Inc, is a new biotech company, dedicated to the development of
diagnostic tests for common genetic diseases. CKB Diagnostics has acquired rights to
the development and commercialization of a diagnostic test for new mutations in the
CFTR gene, which have been implicated in the development of cystic fibrosis (CF).
Cystic Fibrosis is a genetic disease that affects the lungs, pancreas and other internal
organs.
You are a new member of the research team at CKB Diagnostics. This is your first job
and you want to give the best impression to your supervisors. While your major in
college was Biology and you have just completed a master’s degree in Molecular
biology and Biotechnology, your passion is science writing. Your new job requires you
to help with designing and developing the new genetic test as well as to prepare a
patient pamphlet, explaining “What you need to know” about the new test.
Disclaimer: all information in this case study is fictional
1
Project 1 Concepts in Biology
Overview
CKB Diagnostics has acquired the specific location and nature of four new CFTR gene
mutations that were identified in cystic fibrosis patients and were absent in unaffected subjects.
You will need to evaluate these mutations and based on their nature and location within the
gene, decide which one would be more likely to associate with the disease. When you have
picked the candidate mutation, you will set up to design primers for a PCR reaction that will
detect the presence of this mutation in the DNA of patients. This PCR reaction will become the
basis for the new commercially available genetic test.
Your next task will be to describe this genetic test in a patient pamphlet. This pamphlet will
include the following information: (1) What is cystic fibrosis? What causes it? (2) How is cystic
fibrosis inherited? (3) What is a PCR-based DNA test? (4) What will you learn about your
disease with the test? (5) How does the test may help your treatment? (6) Factors that could
affect test results.
These pamphlets tend to run ~3-4 slides not including cover, table of contents and bibliography.
Completion of the pamphlet will require outside research, therefore sources should be cited as
appropriate and a bibliography included at the end.
Schedule and basic description of Project Parts
Part 1 – Due week of 2/20 (5 points)
Read background information and answer questions. Printed copy due in recitation on
2/23 or 2/24.
Part 2 – Due week of 2/27 (5 points)
Perform DNA analysis and answer questions. Printed copy due in recitation on 3/2 or
3/3.
Part 3 – Due week of 3/6 (5 points)
Design a PCR-based genetic test. Printed copy due in recitation on 3/9 or 3/10.
Part 4 – Due week of 3/20 (25 points)
Patient pamphlet, uploaded on Moodle by 3/24, 11:59pm.
2
Project 1 Concepts in Biology
PART 1
Goals: Understand disease genes, dominant and recessive inheritance, expressivity of
mutations.
How Do Genes Work?
Genes are often called the blueprint for life, because they tell each of your cells what to do and
when to do it: be a muscle, make bone, carry nerve signals, and so on. And how do genes
orchestrate all this? They make proteins. In fact, each gene is really just a recipe for a making a
certain protein.
And why are proteins important? Well, for starters, you are made of proteins. 50% of the dry
weight of a cell is protein of one form or another. Meanwhile, proteins also do all of the heavy
lifting in your body: digestion, circulation, immunity, communication between cells, motion-all are
made possible by one or more of the estimated 100,000 different proteins that
your body makes.
But the genes in your DNA don't make protein directly. Instead, special proteins called enzymes
read and copy (or "transcribe") the DNA code. The segment of DNA to be transcribed gets
"unzipped" by an enzyme, which uses the DNA as a template to build a single-stranded
molecule of RNA. Like DNA, RNA is a long strand of nucleotides.
This transcribed RNA is called messenger RNA, or mRNA for short, because it
leaves the nucleus and travels out into the cytoplasm of the cell. There, protein factories called
ribosomes translate the mRNA code and use it to make the protein specified in the DNA recipe.
If all this sounds confusing, just remember: DNA is used to make RNA, then RNA is used to
make proteins-and proteins run the show.
"Junk" DNA
Scientists first studying DNA sequences were surprised to find that less than 2% of human DNA
codes for proteins. If 98% of our genetic information (or "genome") isn't coding for protein, what
is it for?
At first it wasn't clear, and some termed this non-coding DNA "junk DNA." But as more research
is done, we are beginning to learn more about the DNA between the genes-intergenic DNA.
Intergenic DNA seems to play a key role in regulation, that is, controlling which genes are
turned "on" or "off" at any given time.
For example, some intergenic sequences code for RNA that directly causes and controls
reactions in a cell, a job that scientists originally thought only proteins could do.
Intergenic DNA is also thought to be responsible for "alternative splicing," a kind of mix-andmatch process whereby several different proteins can be made from one gene.
In short, it now seems that much of the interest and complexity in the human genome lies in the
stuff between the genes... so don't call it junk.
A gene is a distinct stretch of DNA that determines something about who you are. Genes vary in
size,
from just a few thousand pairs of nucleotides (or "base pairs") to over two million base pairs.
3
DNA is a twisted double
strand of nucleotides and
a phosphate backbone.
Project 1 Concepts in Biology
Mutations and Disease
DNA is constantly subject to mutations, accidental changes in its code. Mutations can lead to
missing or malformed proteins, and that can lead to disease.
We all start out our lives with some mutations. These mutations inherited from your parents are
called germ-line mutations. However, you can also acquire mutations during your lifetime. Some
mutations happen during cell division, when DNA gets duplicated. Still other mutations are
caused when DNA gets damaged by environmental factors, including UV radiation, chemicals,
and viruses.
Few mutations are bad for you. In fact, some mutations can be beneficial. Over time, genetic
mutations create genetic diversity, which keeps populations healthy. Many mutations have no
effect at all. These are called silent mutations.
But the mutations we hear about most often are the ones that cause disease. Some well-known
inherited genetic disorders include cystic fibrosis, sickle cell anemia, Tay-Sachs disease,
phenylketonuria and color- blindness, among many others. All of these disorders are caused by
the mutation of a single gene.
Most inherited genetic diseases are recessive, which means that a person must inherit two
copies of the mutated gene to inherit a disorder. This is one reason that marriage between close
relatives is discouraged; two genetically similar adults are more likely to give a child two copies
of a defective gene.
Diseases caused by just one copy of a defective gene, such as Huntington's disease, are rare.
Thanks to natural selection, these dominant genetic diseases tend to get weeded out of
populations over time, because afflicted carriers are more likely to die before reproducing.
Scientists estimate that every one of us has between 5 and 10 potentially deadly mutations in
our genes- the good news is that because there's usually only one copy of the bad gene, these
diseases don't manifest.
Cancer usually results from a series of mutations within a single cell. Often, a faulty, damaged,
or missing p53 gene is to blame. The p53 gene makes a protein that stops mutated cells from
dividing. Without this protein, cells divide unchecked and become tumors.
Stanford at The Tech Understanding Genetics http://genetics.thetech.org/about-genetics/mutations-anddisease
Read:
What is cystic fibrosis? http://www.yourgenesyourhealth.org/cf/whatisit.htm
Reduced penetrance and variable expressivity
4
Sickled blood cells (left) and normal
blood cells.
https://ghr.nlm.nih.gov/primer/inheritance/penetranceexpressivity
Project 1 Concepts in Biology
Part 1 Assignment (5 points)
P
Answer the following questions in a sentence or two for each part of the question. You
aren’t graded by length of the answer, so be direct. We expect you to write in complete
sentences, with proper grammar and punctuation. Explain the answers in your own
words - DO NOT directly quote your sources. For each question, include a list of all the
sources you used to research that question. If you were writing formally (like in the final
part of this Project), you would need to follow the citation formats we discussed in class,
but for this assignment, you do NOT need to indicate which information came from
which source and citation format is not important (a website name and its URL is
sufficient). Bring printed copy in recitation.
1.
2.
3.
4.
5.
Doallgeneticmutationscausediseasesordisorders?Whyorwhynot?
Which gene is mutated in cystic fibrosis? What chromosome is it located on?
Whywouldprospectiveparentswanttobetestedforcysticfibrosismutations?
Whatiscalledpenetranceingeneticdiseases?
PART 2
Goals: Describe features in a DNA sequence that contains a gene. Evaluate different
types of mutations for their potential to cause disease.
Case study
Four new mutations in the gene CFTR have been associated with a higher risk of
developing cystic fibrosis. Three of the mutations are single base changes that map in
the transcribed region of the gene, whereas the fourth mutation is a small deletion of 7
base-pairs that maps in the upstream non-transcribed region of the gene (mutations are
marked with a green box).
The sequence below represents the part of the sequence of the sense strand of CFTR
(also called coding or non-template strand). Various features of this sequence are
indicated on the sequence as well (+1, AUG, introns, stop codon, polyA signal, location
of mutations). Below the DNA sequence there is an explanation of some of these
features:
CTGAGAAGC....... Transcribed sequence (in red type) AATTAAGAT...... Un-transcribed
sequence (in black type) GCCAACTTC........ intron sequence
The mark the identified mutations
The mark the start and stop codon and polyA signal
rinted copy due in recitation on 2/23 or 2/24.
What is a gene composed of? Where do genes reside in the cell? What do genes
produce?
AATC...
green boxes
ATG
magenta boxes
5
Project 1
Part of the CFTR gene sequence
NOTE – make sure you print or view this page in color!
5’ GATGCCGTGCTCCAGGCACAATCTCTTCCAGAACTCGAAACCAACTG
AATGGAGTGATCTCGATCAAGCCGGAGCTTCTCTTAACTTCGATTTCGAC
GTGAAGAACTTACTTTGATTGCCACATTGGCCCAATTGAAGGGTTATAAT
CTCGCTGGGCATTTTGCTCGAATTGCAGTTTAGTTAATTTCGCTTCTTTC
TCAGTAAATAATAACTGTGCATCGAAGGCCAACTGGAGATGGAAGTGGAA
GTCATTAATATCGATATACAAGAAGTACAATACAACAGTAAGTTATTACC
TATTTTTCTTTACTAATCTTTATGATTTATTTAATGTTATTGGACTTATA
GAAAATACTTAGAATTAAGATTTGATCCATTTTTTTTTTAAATATTTAGG
TTCAAATAAATTAGCCATAGTTATATATTTTTTATGTTTTCATTTACATA
AAACATTAACTGTTATTTTTTTAAATTTAAAGGACTAGCTTTTTCAATTG
TACAGCACACCCTGTGGCTGCGAGTAACGGTTCTCGGGAGTCGTTATTTT
+1 CTGAGAAGCGCGCAACGTGCACACTGGCAGGCTGATTGAAAAAA5T0TCGTT
GCAAATGTTTATGTACAAATATTGAATAAAAAATAAAAATGCTGCGGCAG
GAGAACTTGGCAGCCAACTTCTGCGGTCTCCTGGCCAGCCAGGGCTATAA
AGGTGAGTTCGTATTTCGCCAATTTACTCCGAGCCTCATGGATGTCCGTA
AAAATCGCAGAGAAGGCAAACGAGTGGCGCATTTTGGGCCAGGAACAGGA
TGGATCTCTGCTCACGTCCTCGATATTCGAGTACGCGGACGAGGATCAGC
GCAAGGAGACGTGCATTGGCCACTTTCACGCCACCAAGAAGCAGCTGCGA
CTCCTTTGGACCCTCGACAATTGCCGTGAGATCGTCCAGGCAACGATTAA
CAGCAGTGTCACATTGCTGTCCTTCGTGGAGAAAACTGAGGGCAAGCTCT
ATCAGGCCTTTGTCGTGGAGGTAAGGAGCTCCGAAGGTGGCACGGCCACG
CCCCTCAACTCGGAGCCCTCCAACCGCCAGATGATGACGCAGTTCCTGTG
GCGCGTCGAGAGTGCCACGCGCACCTGCTGGCAGGACAAGCTACTGGTGC
TCACCCACGAGGAATGTAGGTGTCATGTATATGTCATTATCCACCTCTAA
CTCCCATGCTCGTACCTGTTTTTTCTAGCCATCAAGCAGTACAGCTGCGT
GGTCAAGCAGAGCTCCACCACATGCTCGACTGGCGGAGGCGAGGGCAGCG
CCTGGAGGCTAGACACCAGCATACTGACCTACGAAACGCTGGCCAGGAAC
TTTAGCTGGGCCCAGTGGGATCCCGAGTGCCAGGCTCTTTATTACATTCA
CTTGAAGCCGAAGGCCAAGAGCCTCAGTCTGCTGGACGAGAGGGAGGAGG
CTGGCGAGCAGACAACTCCTACTTTAAGCCCCACGCTCTCCGCCTTTCAG
TTTAACAATAAACAGCCAACGGAAACAGTGGTAGGTACTTAAAGATTAAA
TGACTGTGCGTTAGGTCCTGTTCATTGGTACCCTTTATGAGTTAATTCAA
ACCCACGGACATGCTAAGGGTTAATAAACAATCATATCGCTGTCTC 3’
Concepts in Biology
Mutation 1
AATCTCT
Deleted bases in some patients
Mutation 2
G changed to A in some patients
Mutation 3
C changed to T in some patients
Mutation 4
G changed to C in some patients
6
Project 1 Concepts in Biology
Part 2 Assignment (5 points)
Due printed in recitation on 3/2 or 3/3
Answer the following questions in your own words, and bring printed copy in recitation.
1. In a short paragraph below, please describe how you think that each mutation
identified on the previous page might affect the function of the CFTR gene. Hint: first
examine if the mutation might affect the encoded protein or the regulation of expression
of the gene. Describe the hypothetical mechanism of how each of these mutations
might impair the function of the CFTR gene.
2. Based on your previous analysis, which mutation do you think is most likely to cause
the disease?
3. If you decided to develop a genetic test for this disease, which human tissue would
you use as a sample?
PART 3
Goals: Learn how Polymerase Chain Reaction (PCR) can be used to detect known
disease mutations, understand the basics of genetic testing and the benefits and
limitations of genetic testing.
Genetic Testing
Have you ever had your genes tested? Probably not. DNA testing is still pretty limited, although
it is becoming more and more common, especially for fetuses and newborns.
Many prospective parents, especially those with a history of genetic disease in the family, seek
genetic testing and counseling before having children. Genetic counselors can evaluate genetic
tests and advise people of the risk of conceiving a child with recessive, inherited diseases like
sickle cell anemia, Tay- Sachs disease, or cystic fibrosis.
Genetic tests can be performed on fetuses by taking cell samples from the womb. The two
techniques available are called amniocentesis and chorionic villi sampling. Down syndrome, a
condition caused by having an extra chromosome, is tested for this way. After birth, most
newborns are given a blood test for phenylketonuria, a genetic disease that can cause mental
retardation if it goes undiagnosed.
Not all genetic testing is focused on children. Testing is also done to match organ donors and
recipients, to establish paternity or maternity, and in forensics, for identifying evidence from
crime scenes. Testing can also help diagnose adult-onset inherited diseases, such as
Huntington's disease.
Genetic tests are now available for a range of cancers. These tests don't test for cancer directly,
but instead indicate an increased likelihood of developing a cancer. Likelihood is far from
certainty, and cancer may or may not develop, since it must be triggered by additional
mutations.
7
Project 1 Concepts in Biology
Meanwhile, many cancers develop in persons without so-called "cancer genes." For example,
the two gene variants that have been linked with breast cancer, called BRCA1 and BRCA2, are
involved in only 5% of breast cancer cases.
The decision to be tested can be loaded. What if a gene test told you that age 40 or so, you
would start to lose control of your muscles and live a shorter lifespan? This is the case in
Huntington's disease, which has no cure. Perhaps you would rather not know, but the
information might also guide your life decisions, such as when or whether to have children.
Biochips
Biochips, also called DNA arrays or microarrays, are a new technology that promises to speed
and simplify a wide range of genetic tests.
Each small glass slide or "chip" contains rows and rows of DNA probes, which test for the
presence of a specific DNA sequence or mutation. If the mutation or sequence is present in the
DNA being tested, a specific spot on the biochip will glow under special light. A biochip can test
for thousands of mutations at once.
Biochips could be the first step towards genetic ID cards. Imagine something like a credit card,
except this card would carry all of your genetic information. Your doctors could use this DNA
data to tailor your medical care and choose the right drugs and dosages.
Stanford at The Tech Understanding Genetics http://genetics.thetech.org/about-genetics/genetic-testing
PCR (Polymerase Chain Reaction)
Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th
century in molecular biology. Small amounts of the genetic material can now be amplified to be
able to identify, manipulate DNA, detect infectious organisms, including the viruses that cause
AIDS, hepatitis, tuberculosis, detect genetic variations, including mutations, in human genes
and numerous other tasks.
PCR involves the following three steps: Denaturation, Annealing and Extension. First, the
genetic material is denatured, converting the double stranded DNA molecules to single strands.
The primers are then annealed to the complementary regions of the single stranded molecules.
In the third step, they are extended by the action of the DNA polymerase. All these steps are
o
o
o
temperature sensitive and the common choice of temperatures is 94 C, 60 C and 70 C
respectively. Good primer design is essential for successful reactions. The important design
considerations described below are a key to specific amplification with high yield.
http://www.premierbiosoft.com/tech_notes/PCR_Primer_Design.html
Primer Length: It is generally accepted that the optimal length of PCR
primers is 18-22 bp. This length is long enough for adequate specificity and
short enough for primers to bind easily to the template at the annealing
temperature.
2. GC Content:
1.
The GC content (the number of G's and C's in the primer as a percentage of
the total bases) of primer should be 40-60%.
8
Project 1 Concepts in Biology
How does PCR work? PCR virtual lab http://learn.genetics.utah.edu/content/labs/pcr/
Watch this 3D-PCR animation:
https://www.dnalc.org/view/15475-The-cycles-of-the-polymerase-chain-reaction-PCR-3Danimation-with- no-audio.html
Genetic Testing – Risks and Limitations
https://ghr.nlm.nih.gov/primer/testing/riskslimitations?_ga=1.156585977.316888639.148710201
6
Part 3 Assignment (5 points)
Due printed in recitation on 3/9 or 3/10.
Bring printed copy of your results in recitation. Include the provided sequence of the
CFTR gene and mark clearly where your PCR-amplified region of the DNA lies. You can
copy the sequence from Part 2 of the packet and paste it in a new word file. (A word
document of the sequence can be found on moodle, for easier copying.)
Design a genetic test based on a PCR reaction
Your company has decided to develop a genetic test that will be used to diagnose the
genotype of candidate CF patients and evaluate their risk of developing the disease.
Due to cost considerations, this genetic test will consist of a single PCR-amplification
reaction of genomic DNA. The amplified fragment should be around 200 base pairs.
Although cellular DNA replication employs RNA primers, PCR reactions commonly use
DNA primers, so design your primers to be made of DNA.
In Part 2 of this case study, you selected a mutation that is most likely to cause the
disease. Design two primers (one forward and one reverse) to be used in the PCR
reaction that will amplify a fragment of approximately 200 base pairs that includes the
mutation. You should aim to have the mutation approximately in the middle of the
fragment, which means that you will amplify around 100 base pairs on each side of the
mutation. Each primer should be 18 nucleotides long and should be at least 50% GCrich. Please write the sequence of your selected primers in the provided space (marking
the 5’ and the 3’ direction of the DNA) and also underline the sequences that you picked
in the genomic fragment that you are given. Also, add the % GC content of your primers
in the provided space. Both primers should be written in the 5’ to 3’ direction.
Forward primer:
__ __ __ __ __ __ __ ______________________
Reverse primer:
__ __ __ __ __ __ __ ______________________
%GC_____
%GC_____
9
Project 1 Concepts in Biology
PART 4
Goals: Design a patient information pamphlet for the new CF genetic test developed by
CKB Diagnostics.
Part 4 Assignment (25 points)
Design a patient pamphlet - uploaded as a pdf file on Moodle by 3/24, 11:59pm
Your pamphlet should explain the availability of the new genetic test for cystic fibrosis and
should include answers to /description of all the topics listed below. You will upload your
pamphlet on Moodle. A template for the pamphlet and a grading rubric will be provided on
Moodle. Make sure you refer to the rubric when preparing your pamphlet!
Make sure you cite your sources within the text, as discussed in lecture. Include the full citation
for any sources that you used as references for this paper at the end of the document. Follow
APA format for your citations. See the following website or links on moodle for help with that
formatting: https://owl.english.purdue.edu/owl/resource/560/05/
New Genetic Test for Cystic Fibrosis - “What you need to know”
o What is cystic fibrosis (CF)? What causes it? How is CF inherited?
o Why some mutations might cause CF symptoms while other mutations might not? In
which part of the CF gene is the mutation that is detected by the new genetic test
located? How is this new mutation affecting the CF gene?
o What is a PCR-based DNA test? Your company is planning to file a patent to protect
the use of their genetic test. The US patent office requires submission of the sequence
of the primers that are used in the new genetic test. Provide the sequence of the
primers that your team designed, the information about the GC content and explain why
these particular primers will have good specificity for the PCR reaction. Also describe
which part of the CF gene you are amplifying and provide the sequence of the amplified
fragment
o What will you learn about CF with the test?
o Factors that could affect test results
Consider the diversity of patients relying on your pamphlet!