* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Old Exam 2
Transfer RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Holliday junction wikipedia , lookup
SNP genotyping wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Metagenomics wikipedia , lookup
Minimal genome wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genetic code wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA vaccination wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Human genome wikipedia , lookup
History of RNA biology wikipedia , lookup
Epigenomics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
DNA polymerase wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Microevolution wikipedia , lookup
Microsatellite wikipedia , lookup
Genome editing wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Primary transcript wikipedia , lookup
Exam 2 MCB2610 May 2014 Name_________________________ 1. In many bacteria, the electron carrier __________ is used for biosynthesis, whereas __________ feeds the electron transport system. a. NADPH; NADH d. all of the above b. FADH2; NADPH e. none of the above c. NADH; acetyl-S-CoA -----------------------------2. The enzyme pyruvate kinase catalyzes the conversion of phosphoenolpyruvate to pyruvate; the phosphate group is transferred to ADP to form ATP. This reaction is an example of: a. ATP synthesis by substrate-level phosphorylation b. the use of a proton concentration gradient by [H+]-ATPases to synthesize ATP c. ATP coupled to FADH2 oxidation d. a P-Type ATPase activity e. none of the above ----------------------------3. Fatty acids enter the TCA cycle after being degraded to what molecule? a. acetyl-phosphate d. all of the above b. malonyl-S-CoA e. none of the above c. acetyl-S-CoA ----------------------------4. Bacteria synthesize ribose for nucleotides using which pathway? a. Embden-Meyerhoff-Parnas d. tricarboxylic acid cycle b. Entner-Doudoroff e. all of the above c. pentose phosphate shunt ----------------------------5. Which of the following is the best definition of fermentation? A) The reduction of glucose to pyruvic acid B) The complete catabolism of glucose to CO2 and H2O C) The oxidation of a carbohydrate with organic molecules serving as electron donors and acceptors D) The production of ATP from glucose E) The production of ethanol from glucose ----------------------------6. How does fermentation of glucose differ from the oxidation of glucose? A) Fermentation of glucose is anaerobic; oxidation of glucose can be aerobic or anaerobic. B) Fermentation produces less ATP per glucose molecule than oxidation does. C) Glucose is fermented by a different metabolic pathway than when it is oxidized by respiration. D) Both a and b E) All of the above ----------------------------7. What is the biological function of NAD+? A) Accept electrons released by the oxidation of organic molecules B) Provide electrons for the oxidation of glucose C) Provide electrons for the reduction of pyruvic acid to lactic acid D) Provide electrons for the substrate-level phosphorylation of ADP to ATP E) None of the above ----------------------------- 8.A quorum-sensing gene system requires the accumulation of a secreted small molecule called a(n): a. autoinducer d. inducer b. activator e. corepressor c. repressor ----------------------------9.In a two-component signal transduction system, a _________ is transferred from a sensor kinase to a _________ in response to an environmental signal. a. phosphate; sensor domain d. magnesium; sensor domain b. phosphate; sensor phosphatase e. magnesium; response regulator c. phosphate; response regulator ----------------------------10. Promoters are specific sequences of __________ and in synthesizing RNA, the polymerase moves __________ the promoter. A) DNA / toward B) RNA / toward C) DNA / away from D) RNA / away from ----------------------------11. Two-dimensional gel electrophoresis separates proteins based on: a. charge and size. b. size and sequence. c. charge and amino acid content. d. size and amino acid content. e. charge and mass ----------------------------12. Say you were studying the genetics of a newly discovered species, Intel degradus, and you found 6 genes scattered around the organism's linear chromosome which allowed the organism to breakdown silicon. Further study revealed that all 6 genes were under the control of a repressor which you call slcR. In class we discussed gene control hierarchies--the genes described above are an example of what? A) a regulon B) a stimulon C) an operon D) a positive control system E) a negative ground state ----------------------------13. A consensus sequence consists of: a. the region to which sigma factors can bind b. the most likely base (or bases) at each position c. hairpins in RNA to slow down or stop transcription d. sequences to which ribosomes bind e. primer sequences used to initiate transcription ----------------------------14. What does it mean to say that the genetic code is redundant? a. There is more than one kind of amino acid in proteins. b. More than one rRNA can bind to the ribosome at the same time. c. A codon is composed of more than one nucleotide. d. More than one codon can specify the same amino acid. e. All products of translation contain a certain minimum number of mistakes, called mutations. ----------------------------- 15. Peptide bond formation effectively transfers the peptide from the tRNA in the __________ to tRNA in the __________. a. P-site; E-site d. P-site; A-site b. E-site; A-site e. A-site; P-site c. E-site; P-site ----------------------------16. What is the significance of the Shine-Dalgarno sequence? a. It is the site where RNA polymerase binds to begin transcription. b. It is the site where a ribosome binds so that it can initiate translation. c. It is the site where DNA polymerase binds to begin chromosome replication. d. It is the site where the tRNA binds to the mRNA in translation. e. It is the site where DNA polymerase begins synthesis of the Okazaki fragments on the lagging strand. ----------------------------17. Which of the following sequences would pair with the sequence 5’ UACCAGCUG 3’? A) 3’ GTCGACCAT 5’ B) 3’ ATGGTCGAC 5’ C) 5’ GUCGACCAU 3’ D) 5’ ATGGTCGAC 3’ E) 5’ AUGGUCGAA 3’ ----------------------------18. The E site on the ribosome is the site where A) ribosomes enter to begin translation. B) tRNA enters the ribosome. C) tRNA is released from the ribosome. D) ribosomes exit to end translation. E) mRNA binds to the ribosome. ----------------------------19. What is the role of sigma70 in E. coli? A) To guide RNA polymerase to generic, housekeeping promoters B) To guide RNA polymerase to heat shock promoters C) To guide DNA polymerase to generic, housekeeping promoters D) To guide DNA polymerase to heat shock promoters E) To stop transcription at Shine-Dalgarno sequences ----------------------------20. The smallest cellular genomes identified thus far are those of: a. E. coli d. Mycoplasma b. Staphylococcus e. yeast c. Streptococcus ----------------------------21. Accidental errors during replication are corrected by the DNA proofreading activity intrinsic to: a. DNA polI d. DNA polIV b. DNA polII e. DNA polV c. DNA polIII ----------------------------- 22. When the chromosome replicates, how is the newly made strand related to its template strand? a. The two strands have identical sequences and are parallel to each other. b. The two strands have complementary sequences and are parallel to each other. c. The two strands have identical sequences and are antiparallel to each other. d. The two strands have complementary sequences and are antiparallel to each other. e. The two strands have identical sequences and are antiparallel to each other, except that U replaces T. ----------------------------23. Imagine that you are designing an artificial chromosome to carry a large set of genes that encode proteins that can convert lead to gold. Your first task is to make an OriC region that will allow the chromosome to be replicated. Which of the following sequences would be your best choice for the region of your new OriC that will separate during the open-complex-formation step of replication? A. 5’ GGATTTTATTAAATCAATCA 3’ 3’ CCTAAAATAATTTAGTTAGA 5’ B. 5’ GATCGATCGATCGATCGATC 3’ 3’ CTAGCTACCTAGCTAGCTAG 5’ C. 5’ GGCACGAATCGCGGGCAATC 3’ 3’ CCGTGCTTAGCGCCCGTTAG 5’ D. 5’ TCGATCGATCGATCGATCGA 3’ 3’ AGCTAGCTAGCTAGCTAGCA 5’ E. 5’ GCGCGGGCGCGCCGCGGCGC 3’ 3’ CGCGCCCGCGCGGCGCCGCG 5’ ----------------------------24. Imagine had identified an organism that you thought was a new pathogen, which, unfortunately, you were having trouble getting to grow. In desperation, you had the organism sequenced and after analyzing the genome you found that it lacked superoxide dismutase, and was lac-. Of the conditions listed below, which would be your best option for getting growth? A) Minimal B) Minimal C) Minimal D) Minimal E) Minimal ------- medium medium medium medium medium with with with with with H2O2 as an oxygen source glucose as a carbon source, lactose as a carbon source, glucose as a carbon source, lactose as a carbon source, in in in in an an an an aerobic environment anaerobic environment anaerobic environment anaerobic environment 25. The E. coli chromosome is about 4 million basepairs in size. If DNA polymerase moves at a rate of 1000 basepairs per second, how long will it take to replicate the chromosome (be careful!). A) About B) About C) About D) About ------- 4000 minutes 15 minutes 35 minutes 70 minutes 26. Imagine that you have found a set of 8 genes that causes a bacterium (Facilemelodius rouge) to glow red in the presence of easy-listening music. One of the genes encodes a protein that senses the music, and you name it ezlS. A quick mapping of the remaining 7 elz genes shows that they are in 3 clusters at different spots on the bacterial chromosome. Upon inactivating ezlS you discover that the cells always red even in the presence of an extremely strong repressor like Genkenuberstein's metal masterpiece “Speed Rune”. Which of the following statements is true based on the information given above? A. The 7 B. The 7 C. The 7 D. The 7 ------27. A. B. C. D. E. elz elz elz elz genes genes genes genes form form form form a regulon a regulon an operon an operon under under under under negative positive negative positive control control control control Consider the molecule shown below, in what structure would it be found? DNA Ribosomes mRNA Two of the above All of the above ----------------------------28. Consider the following piece of DNA. Which part of it is the very oldest? TTAGATCTCGGATTACGTATTCGACGTAGCGGCTAGCTCTCGGCAGGATCGGCTCGAGAATCGGTTCAGGATCGGC 3’ 3’ AATGGCTAGCCTAATGCATAAGCTGCATCGCCGATCGAGAGCCGTCCTAGCCGAGCTCTTAGCCAAGTCCTAGCCG 5’ / / methyl methyl A. The left end of the top strand B. The right end of the top strand C. The left end of the bottom strand D. The right end of the bottom strand ----------------------------29. During DNA replication in E. coli, all newly synthesized strands of DNA begin with a small piece of RNA. Why? A. Because DNA PolIII cannot start a new DNA chain but it can add dNTPs to a piece of RNA. B. Because DNA ligase cannot seal nicks in DNA, but it can seal nicks between RNA and DNA. C. Because RNA is more stable than DNA. D. Because the leading strand is made in many small fragments. E. Because the lagging strand is made in many small fragments. ----------------------------- 30. Which of the following statement about the DNA duplexes shown below is true? #1 5’ TTCGATCC 3’ 3’ AAGCTAGG 5’ #2 3’ CCTAGCTT 5’ 5’ GGATCGAA 3’ A. Only #1 is incorrectly drawn. B. #1 and #2 show the same molecule. C. Both #1 and #2 are incorrectly drawn. D. Only #2 is incorrectly drawn. ------------------31 Your friend, Newton G.C. Finster, has fallen hard for his Bio107 lab partner Anita Taratina. After searching the Web has found a perfect gift which he wants to use to declare his affection. Fig YY, at the end of the exam, shows this gift-it’s a ring and finger made, each made of a piece of single stranded DNA that has paired with itself. Knowing that you’re in MCB2610 Newton asks you what you think of this opportunity. After looking at the gift, you wonder about his sense of taste, but offer him the following advice based on what you’ve learned about DNA structure. (By the way, don’t worry about the AT finger melting apart--the gift comes with a self-cooling storage system.) A. Don’t by the set, because assemble as advertised. B. Go ahead and buy the set, C. Don’t by the set, because assemble as advertised. D. Don’t by the set, because advertised. --------------------- she’ll be getting a finger, but the ring won’t the DNA should form the structures as advertised she’ll be getting a ring, but the finger won’t neither the ring nor the finger will assemble as 32. The normal mutation rate for most bacteria is on the order of 10-9 mutations per base pair. However, one can often isolate “mutator” strains of bacteria which mutate at a much higher rate. Suppose that you have isolate a bacterial species which converts gold to lead (Leadto goldus), and you were interested in finding a mutant which did the reverse reaction. If, with wild-type L. goldus (average 10-9 mutations per base pair and genome size of 3 million base pairs) you found the mutant you wanted once in every million colonies, how often you find the same type of mutant if you used a “mutator” strain with a mutation rate of 10-5 muations per base pair? 33. In the November 1999 issue of the Journal of Bacteriology, Ding et. al describe a protein from Acetivibrio cellulolyticus which functions as a scaffold to hold seven proteins needed to degrade cellulose. The protein is called scaffoldin and the sequence for the promoter region and the first part of the gene is given below: -35 -10 5’ATTCTATTTATCCCAAGTGTTCTCTGGTAACATATTTGTTTCGTACAAGTTTTACTTATTAACATGAG AGACAATAACTAACATGTATTAGGTATTTGTTTTTTTTGGGTACCTTAAAGATCTTTAAATAGATCATATAA Shine-Dalgarno AAATAAAATTTTGGGAGGAACGGTTAAATGAAAAAGGTTATCAGTATCAGTATTGATTTTAGCTATCG-3’ A. The nontranscribed strand is shown above. be. Show about where the +1 site would B. What are the first six amino acids of scaffoldin? end of the exam for the decoding. Use the codon table at the 34. Explain why the molecule shown below inhibits the genome replication of HIV. 35. Draw a diagram of the Lac region of E. coli when lactose is absent. Include the following items: LacI tetramer, Lac promoter region with -35, -10, +1 sites, The start codon of lacZ operators O1 and O3 and looped DNA. Fig. YY. Ring and finger