* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download [001-072] pierce student man
Nutriepigenomics wikipedia , lookup
Human genome wikipedia , lookup
Metagenomics wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
DNA vaccination wikipedia , lookup
RNA interference wikipedia , lookup
Transposable element wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Epigenomics wikipedia , lookup
Microevolution wikipedia , lookup
Messenger RNA wikipedia , lookup
DNA polymerase wikipedia , lookup
Point mutation wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
Helitron (biology) wikipedia , lookup
RNA silencing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Transcription factor wikipedia , lookup
Epitranscriptome wikipedia , lookup
Non-coding DNA wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
[001-072] PIERCE STUDENT MAN 8/22/01 13 2:01 PM Page 36 Transcription *1. Write the consensus sequence for the following set of nucleotide sequences. A G G A G T T A G C T A T T T G C A A T A A C G A A A A T C C T A A T T G C A A T T **2. List at least five properties that DNA polymerases and RNA polymerases have in common. List at least three differences. *3. An RNA molecule has the following percentages of bases: A = 23%, U = 42%, C = 21%, G = 14%. a. Is this RNA single-stranded or double-stranded? How can you tell? b. What would be the percentages of bases in the template strand of DNA that contains the gene for this RNA? **4. Shown below is a DNA molecule that is part of the RNA-coding sequence of a transcription unit. The top strand is the template strand. Indicate the direction of transcription and give the sequence found on the RNA molecule transcribed from this DNA. Label the 5' and 3' ends of the RNA. 5'–G C A A A T G G C A T G T A–3' ← template strand 3'–C G T T T A C C G T A C A T–5' **5. Write out a hypothetical sequence of bases that might be found in the first 40 nucleotides of a promoter of a prokaryotic gene. Include both strands of DNA and label the 5' and 3' ends of both strands. Be sure to include any consensus sequences found in the promoter and the start site for transcription. 36 Pierce, Genetics: A Conceptual Approach [001-072] PIERCE STUDENT MAN 8/22/01 2:01 PM Page 37 Pierce, Genetics: A Conceptual Approach Chapter 13 Transcription **6. The diagram below represents a transcription unit on a DNA molecule. a. Assume that this DNA molecule is from a prokaryotic cell. Draw in the approximate location of the promoter and terminator for this transcription unit. b. Assume that this DNA molecule is from a eukaryotic cell. Draw in the approximate location of an RNA polymerase II promoter. c. Assume that this DNA molecule is from a eukaryotic cell. Draw in the approximate location of an internal RNA polymerase III promoter. Transcription start site 5' 3' 3' 5' Template strand **7. The following DNA nucleotides are found near the end of a prokaryotic transcription unit. Find the terminator in this sequence. a. Mark the point at which termination will occur. b. Is this an intrinsic terminator or a rho-dependent terminator? c. Draw a picture of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form. 3'–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5' *8. A strain of bacteria possesses a temperature-sensitive mutation in the gene that codes for the rho subunit of RNA polymerase. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following would you expect to see? a. Transcription never occurs. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands. Explain your reasoning for accepting or rejecting each of these five options. ***9. Enhancers are sequences that affect initiation of transcription occurring at genes that are hundreds or thousands of nucleotides away. Enhancer-binding proteins usually interact directly with transcription factors at promoters thus causing the intervening DNA to loop out. An enhancer from the bacteriophage T4, which does not function by looping of the DNA, has been described (Herendeen, D. R. et al. 1992. Science 256:1298–1303). Propose some additional mechanisms (other than DNA looping) by which this enhancer might affect transcription at a gene thousands of nucleotides away. 37 [001-072] PIERCE STUDENT MAN 8/22/01 2:01 PM Page 38 Pierce, Genetics: A Conceptual Approach Chapter 13 Transcription ***10. The location of the TATA box in two species of yeast, Saccharomyces pombe and Saccharomyces cerevisiae, differs dramatically. The TATA box of S. pombe is about 30 nucleotides upstream of the start site, similar to the location for most other eukaryotic cells. However, the TATA box of S. cerevisiae can be up to 120 nucleotides upstream of the start site. To understand how the TATA box functions in these two species, a series of experiments was conducted to determine which components of the transcription apparatus of these two species could be interchanged. In these experiments, different components of the transcription apparatus were switched in S. pombe and S. cerevisiae, and the effect of the switch on the level of RNA synthesis and the start point of transcription was observed. TFIID from S. pombe could be used in S. cerevisiae cells and vice versa, without any effect on the transcription start site in either cell type. Switching TFIIB, TFIIE, or RNA polymerase did alter the level of transcription. However, the following pairs of components could be exchanged without affecting transcription: TFIIE together with TFIIH; and TFIIB together with RNA polymerase. Exchange of TFIIE-TFIIH did not alter the start point, but exchange of TFIIB-RNA polymerase did shift it. (Li, Y., P. M. Flanagan, H. Tschochner, and R. D. Kornberg. 1994. Science 263:805–807.) On the basis of these results, what conclusions can you draw about how the different components of the transcription apparatus interact and which components are responsible for setting the start site? Propose a mechanism for the determination of the start site in eukaryotic RNA pol II promoters. 38