Download Sequences 5` to Translation Start Regulate

The Plant Cell, Vol. 1,209-215, February 1989, © 1989 American Society of Plant Physiologists
Sequences 5' to Translation Start Regulate Expression
of Petunia rbcS Genes
Caroline Dean, 1 Mitchell Favreau, John Bedbrook, and Pamela Dunsmuir 2
Advanced Genetic Sciences, 6701 San Pablo Avenue, Oakland, California 94608
The promoter sequences that contribute to quantitative differences in expression of the petunia genes (rbcS)
encoding the small subunit of ribulose bisphosphate carboxylase have been characterized. The promoter regions
of the two most abundantly expressed petunia rbcS genes, SSU301 and SSU611, show sequence similarity not
present in other rbcS genes. We investigated the significance of these and other sequences by adding specific
regions from the SSU301 promoter (the most strongly expressed gene) to equivalent regions in the SSU911 promoter
(the least strongly expressed gene) and assaying the expression of the fusions in transgenic tobacco plants. In this
way, we characterized an SSU301 promoter region (either from -285 to -178 or -291 to -204) which, when added
to SSU911, in either orientation, increased SSU911 expression 25-fold. This increase was equivalent to that caused
by addition of the entire SSU301 5'-flanking region. Replacement of SSU911 promoter sequences between -198
and the start codon with sequences from the equivalent region of SSU301 did not increase SSU911 expression
significantly. The -291 to - 2 0 4 SSU301 promoter fragment contributes significantly to quantitative differences in
expression between the petunia rbcS genes.
INTRODUCTION
We have characterized the eight rbcS genes that form the
rbcS multi-gene family in Petunia (Mitchell) (Dean et al.,
1985a). Although the rbcS genes show a high degree of
homology within the coding region and also in the 5'- and
3'-flanking regions (Dean et al., 1985b; Dean et al., 1987a),
there is a 100-fold range in expression levels in leaf tissue
(Dean et al., 1985b; Dean et al., 1987b). We are investigating the basis of this differential expression. Our work
has focused upon the most strongly expressed (SSU301)
and the most weakly expressed (SSU911) petunia rbcS
genes. In the preceding paper (Dean et al., 1989), experiments were described in which the sequences of the two
genes were exchanged at their translation initiation codons. The expression levels of these chimeric genes indicated that sequences both 3' and 5' to the translation
start contribute to quantitative differences in expression of
the two genes.
Other studies have focused upon the identification of
sequences conferring the light regulation and tissue specificity of rbcS gene expression (Kuhlemeier et al., 1987a).
Fusion experiments with the promoter regions from two
pea rbcS genes, E9 (Morelli et al., 1985) and ss3.6 (Timko
et al., 1985), indicated that the 5' region of these genes
was sufficient to direct light-regulated and tissue-specific
expression of a foreign gene. Deletion analysis of the
promoter regions was used to define the sequences in1Current address: John Innes Institute, Colney Lane, Norwich,
NR4 7UH, United Kingdom.
2To whom correspondence should be addressed.
volved in light regulation. Differences were observed in the
results of these experiments depending on whether callus
or leaf tissue was assayed, emphasizing the need to
perform these studies on leaf tissue (Nagy et al., 1985).
Analysis of the 5'-flanking regions of the pea rbcS-3A gene
in leaves of transgenic tobacco plants has indicated that
sequences downstream of - 1 6 6 are sufficient for lightregulated expression of the gene at wild-type levels (Kuhlemeier et al., 1987b). A 58-bp region located between
- 1 6 9 and - 1 1 2 has been shown to contain two regulatory
elements that can decrease transcription in the dark. Deletion of this region, however, does not affect expression of
the rbcS-3A gene, indicating that other upstream sequences can substitute for these elements (Kuhlemeier et
al., 1987b).
Comparisons have been made among the Y-flanking
regions of all of the rbcS sequences available from dicotyledonous plants (Manzara and Gruissem, 1988) to
search for conserved sequences that may be important in
the regulation of rbcS expression. A 14-bp region 5'GTGTGGTTAA/CTATG-3', termed box II, is conserved
among all rbcS genes sequenced so far, and this is included within the 58-bp region shown to be important in
the regulation of the pea rbcS-3A gene (Kuhlemeier et al.,
1987b). There is, however, little other homology between
the promoter regions of the pea rbcS genes and other
rbcS genes from petunia and tomato.
The two most strongly expressed petunia rbcS genes,
SSU301 and SSU611, contain blocks of nucleotide sequence not present in the other petunia rbcS genes (Dean
210
The Plant Cell
et al., 1985b). This correlation suggests that these blocks
of nucleotide sequence may be involved in the higher level
of expression observed for these two genes. Homology to
these blocks of nucleotide sequence also occurs in the
promoter regions of the two tomato rbcS genes (Sugita et
al., 1987; Manzara and Gruissem, 1988) and a Nicotiana
plumbaginifolia rbcS gene (Poulsen et al., 1986).
Here we report on experiments that analyze the effects
of these and other sequences within the SSU301 5'flanking region on expression of the petunia rbcS genes.
RESULTS
Construction of Fusions to Test for Sequences
Involved in Differential Expression
A comparison of the 5' regions from five petunia rbcS
genes indicated first that the sequences of the different
genes between the TATA box and approximately 120 bp
upstream are highly conserved in all genes. Within this
region there are blocks of nucleotide sequence that show
complete sequence conservation (up to 13-bp stretches).
Second, upstream of this region, only SSU301 and
SSU611, the two most strongly expressed petunia rbcS
genes, show extensive sequence homology. These two
genes contain three blocks of nucleotide sequence covering 59 bp that differ at only two positions. These blocks
of homology are positioned at -285 to -204 SSU301
(shown in Figure 1) and at -310 to -169 in SSU611 (Dean
et al., 1985b). The nucleotide sequence conserved between all the petunia rbcS genes is probably involved in
the qualitative aspects of their regulation, such as light and
Ode I
High
A
TC
(Sarah I)
Low
Figure 1. Schematic Illustration of the 5'-Flanking Regions of
SSU301 (Upper)and SSU911 (Lower).
The three conserved blocks of nucleotide sequence present only
in petuniarbcS genes SSU301 and SSU611 are shown as heavy
lines and the actual sequence of the region is included on the
figure. The regions that show a high level of nucleotide sequence
homology between all the petunia rbc,S genes are hatched. Restriction endonuclease sites used and mutations introduced into
the rbcS 5" regions are marked. The numbers on the figure show
positions relative to the major transcription start site for each
gene.
tissue specificity of expression. The extra regions of nucleotide sequence conservation between SSU301 and
SSU611 might contribute to the high expression levels of
these two genes.
Studies that define the c/s-acting elements in 5' promoter regions generally use deletion analysis of the pertinent sequences (Morelli et al., 1985; Nagy et al., 1985;
Timko et al., 1985); however, this type of analysis can give
misleading results if duplicated sequence elements are
involved. We chose to evaluate different regions of the
SSU301 5" region by inserting them into the equivalent
region of the SSU911 gene (the last abundantly expressed
petunia rbcS gene). Schematic illustrations of the 5'-flanking regions of SSU301 and SSU911 are shown in Figure
1. These serve to simplify the region of interest and show
the restriction endonuclease sites used in the cloning
steps, The three conserved blocks of nucleotide sequence
present in SSU301, which are also found in SSU611, are
included on the figure. The regions in the two genes that
show a high level of nucleotide sequence homology among
all petunia rbcS genes are hatched.
Experiments described in the preceding paper (Dean et
al., 1989) using fusions between SSU301 and SSU911
showed that sequences downstream of the coding region
contribute significantly to the quantitative differences in
expression of the petunia rbcS genes. Here we focus on
the contribution of sequences 5' to the start codon. A
fusion between the 5' region of SSU301 and the SSU911
coding region plus 3'-flanking region, where the sequences
of the two genes were exchanged at an Ncol site located
at the translation start (construction 2, Figure 2), was used
as the control in the experiments to show the level of
expression directed by the entire 5' region of SSU301.
We used site-directed mutagenesis (Kunkel, 1985) to
introduce a BamHI restriction site into the SSU911 gene
at position - 1 9 8 (Figure 1). This BamHI site, which was
located at the point at which the sequences of SSU301
and SSU911 diverged, was used for the insertion of a
number of different fragments from the SSU301 promoter.
First, a fragment extending from -1300 to -178 was
introduced in both orientations (constructions 3 and 4,
Figure 2). Second, a fragment extending from -285 to
-178 was introduced in both orientations (constructions 6
and 7, Figure 2). This fragment contained the highly conserved blocks of nucleotide sequence. Third, a fragment
covering the region from -291 to -204 was introduced
(construction 8, Figure 2). This fragment contained mutations at two positions (shown in Figure 1) which create
restriction endonuclease sites (EcoRV and Hindlll) between the blocks of conserved nucleotide sequence. This
was designed to allow for further dissection of the blocks
of nucleotide sequence homology. Fourth, we substituted
the region of SSU911, which is conserved among all the
petunia rbcS genes (shown as a hatched area in Figure 1),
with that from SSU301 (construction 10, Figure 2).
In constructions 3 to 9, SSU301 DNA was inserted into
Upstream Sequences Affect Expression Levels
-285-178
Fusion
#
7V7T
6 c
1=
-198
A A
-178-285
-198
-1300 -178
3 c
-204 -291
8
C
-198
-198
-178 -1300
DCS
4 c
A A
A A
9 c
-198
-198
AA
OCS
10
-182 ATG
Figure 2. Schematic Illustration of the Different Fusions Analyzed.
SSU911 sequences are shown in white, SSU301 sequences in
black, and ocs sequences are hatched. Intron sequences are
shown as triangles. The numbers show positions relative to the
major transcription start site for each gene.
211
we pooled equal amounts of RNA from each of 15 independent transformants (after first looking at the mRNA
levels in individual plants) and repeated the primer extension analysis on the pooled RNA sample. Comparison of
the signals from the pooled RNA samples allowed a quantitative comparison of the expression levels of the different
fusions. This approach assumes that pooling RNA from
15 plants averages the variability among transformants
and that the range of variability in each population is similar.
The primer extension analysis of the pooled RNA samples is shown in Figure 4. Also included are schematic
illustrations and measured expression levels (relative to
SSL/307) of the different constructions. We have calculated
the standard error values for the relative expression levels,
and these are included on Figure 4. The standard error
values show that the relative expression values for the
different fusions need to differ considerably before they
can be considered significant. The primer extended fragments from constructions 2 and 10 are longer than those
of the other constructions because the 5'-untranslated
leader region of SSL/307 is 34 bp longer than that of the
SSL/977 gene.
Replacement of the 5' region of SSL/97 7 with the entire
5' region of SSL/307 (-1300 to +55, construction 2)
resulted in a 25-fold increase in the level of SSL/97 7 mRNA,
the SSL/977 5' region. As a consequence of these insertions, sequences that were normally adjacent were separated from each other. To test whether this sequence
disruption per se affected SSL/977 expression, we
introduced DNA from the octopine synthase gene (ocs)
into the SSU911 promoter. As a control for constructions
3 and 4 (Figure 2), a 1.1-kb ocs fragment was cloned into
the SSL/977 promoter at position -198 (construction 5,
Figure 2). We reasoned that this piece of DNA would be
"transcriptionally neutral" because it specified protein
coding sequence. A 110-bp fragment of the ocs coding
region cloned into the same position in the SSL/977
promoter (construction 9) was used as a control for
constructions 6, 7, and 8 (Figure 2). The fusions were introduced into tobacco plants by Agrabacfe/vum-mediated
transformation.
-198 £ A
Expression of the Fusions in Transgenic Tobacco
Plants
-182 ATG
Primer extension analysis of six of the populations of
transformed plants is shown in Figure 3. There is considerable variability among transformants in the expression
of the introduced gene fusion. The variability in expression
among transformants cannot be accounted for by differences in the copy number of the introduced DNA (Jones
et al., 1987; Odell et al., 1987; Dean et al., 1988). To
quantitate the expression levels of the introduced fusions,
Figure 3. Primer Extension Analysis of Total RNA Isolated from
15 Transgenic Tobacco Plants Containing rbcS Gene Fusions.
Schematic illustrations of the fusions contained in the tobacco
plants are included in the figure. SSL/977 sequences are shown
in white, SSL/307 sequences in black, and ocs sequences are
hatched. Intron sequences are shown as triangles.
212
The Plant Cell
2-FOLD DILUTION SERIES
1 2 3 4 5 6 7 8 9 1 0
-285-178
Fusion
*
1%±0.3
1 1=
25% ±8
6
=2=
198 A A
-178-285
25% ±12
2
25% ±9
16% ±5
±5
20% ± 5
8
8 JL
-198 A A
-178
7% ±2
ocs
-1300
4 1=5
-198
2% ±0.7
9 c
-'9<> A A
ocs
182ATG
0.1% ±0.01
3% ±0.8
10
198 A A
Figure 4. Primer Extension Analysis of Pooled RNA Samples from
Transgenic Tobacco Plants Carrying Different Petunia rbcS Gene
Fusions.
Lanes labeled 1 to 10 show the primer extension analyses of the
pooled RNA samples from plants containing fusions 1 to 10.
These fusions are illustrated schematically at the base of the
figure. SSU911 sequences are shown in white, SSL/307 sequences in black, and ocs sequences are hatched. Intron sequences are shown as triangles. A twofold dilution series was
included to aid quantification of the expression levels relative to
the expression of SSL/307. These are shown as percentages with
standard error values alongside the schematic illustrations.
indicating that sequences 5' to the SSL/307 start site are
involved in high level expression of this gene. When the
region of SSL/307 from -1300 to -178 was added to
SSL/977 (construction 3), the level of SSL/977 expression
increased 20-fold, suggesting that the 5' elements of
SSL/307, which are involved in high level expression, are
located 5' to -178. When the -1300 to -178 fragment
was inverted in the SSL/97 7 promoter (construction 4), the
expression of SSL/977 increased only sevenfold. This orientation-dependent increase in expression is due probably
to the relative positioning of elements (located just upstream of -178) important for high-level expression with
respect to other promoter elements, for example, the
TATA and CCAAT boxes. The insertion of the 1.1-kb ocs
fragment (construction 5) actually decreased the level of
expression of SSL/97 7.
Because the -1300 to -178 SSU301 fragment contains
the three blocks of nucleotide sequence found only in
SSL/307 and SSL/611 (the two strongly expressed rbcS
genes), we prepared a smaller fragment from SSL/307 that
contained only these sequences. The fragment extending
from -285 to -178 (Figure 1) was cloned into the SSL/97 7
5' region in both orientations (construction 6 and 7). Addition of this fragment increased the level of expression of
the SSL/977 gene 25-fold irrespective of its orientation
(Figure 4). This effect parallels the increase in expression
observed after the addition of the -1300 to -178 SSL/307
fragment.
The addition of 110 bp of ocs coding region to the
SSL/97 7 promoter (construction 9) did not alter significantly
the level of expression of SSU911 (Figure 4), indicating
that displacement of SSL/977 sequences 110 bp further
upstream did not compromise their function. The increase
in SSL/97 7 expression after addition of the -285 to -178
SSL/307 fragment thus appears to be the result of specific
SSL/307 sequences.
When the -291 to -204 SSL/307 fragment was added
to the promoter region of SSL/977 (construction 8),
SSL/977 expression increased 16-fold. Examination of the
standard error values shows that this increase is not
significantly different from that caused by addition of the
-285 to -178 SSL/307 fragment. This result demonstrates
that the mutations introduced within the -291 to -204
fragment did not interfere with the ability of the fragment
to increase expression. It also suggests that the SSL/307
sequences between -204 and -178 are not required for
the increase in SSU917 expression.
Experiments with the pea rbcS gene nbcS-3A (Kuhlemeier et al., 1987b) have indicated that sequences downstream of -166 from the transcription start site are sufficient for light-regulated expression of the pea gene at wildtype levels. Therefore, we investigated whether the sequences within a similar region of the SSL/307 gene contributed to the differential expression of this gene relative
to SSL/977. SSL/977 expression did not increase significantly when SSL/977 sequences from -198 to +20 (the
start of the coding region) were replaced with the equivalent SSL/307 sequences (from -182 to +55). This demonstrates that this region does not contain sequences that
contribute to the differential expression of these genes.
DISCUSSION
We analyzed the 5' region of the most strongly expressed
petunia rbcS gene, SSL/307, to investigate which sequences 5' to the translation start are involved in the
quantitative differences in expression of the genes within
this plant multi-gene family. Different regions of the
Upstream SequencesAffect ExpressionLevels
SSU301 promoter region were added to, or substituted
for, an equivalent region of the weakly expressed petunia
gene SSU911, and the expression of the different fusions
was analyzed in transgenic tobacco plants.
Addition of the 5' region of SSU301 from -1300 to +55
(the beginning of the coding region) increased SSU911
expression 25-fold. The same increase was observed
when smaller SSU301 fragments (either -285 to -178 or
-291 to -204) were added to SSU911. We conclude from
these results that the -285 to -204 SSU301 fragment
contains sequence elements that result in quantitative
differences in expression between SSU301 and SSU911.
Since these sequences are not within the transcribed
region of the SSU301 gene, the simplest conclusion derived from these results is that the region of SSU301
between -285 and -204 behaves as an "enhancer-like"
element that increases the level of transcription from the
rbcS promoters. We cannot conclude from these data that
other sequences do not have a significant effect on expression if the -285 to -204 fragment is absent from SSU301.
Insertion of two ocs fragments (constructions 5 and 9)
into the SSU911 promoter region was used to assess the
effects of separating normally adjacent SSU911 sequences. Insertion of a 110-bp ocs fragment did not alter
SSU911 expression significantly; however, insertion of a
1.1-kb fragment decreased SSU911 expression tenfold. It
is possible that the 1.1-kb ocs fragment did not act as
"transcriptionally neutral" DNA. However, it seems more
likely that sequences 5' to -198 in the SSU911 gene are
important for maximal SSU911 expression, and displacement of these sequences over a distance as large as 1.1
kb resulted in their inability to operate normally. As construction 3 is expressed as well as construction 2, it would
appear that sequences in the -1300 to -178 SSU301
fragment can substitute for these important SSU911
sequences.
Presently, we do not know whether all the nucleotide
sequence between - 2 8 5 and - 2 0 4 is required to achieve
the full increase in SSU911 expression. Nucleotide sequence homology to the -285 to -204 SSU301 fragment
is present in the promoter region of an rbcS gene from
Nicotiana plumbaginifolia (Poulsen et al., 1986). A fragment
from the N. plumbaginifolia promoter (located between
-312 and -102), which includes the SSU301 nucleotide
sequence blocks shown in Figure 1, functions as an enhancer conferring light regulation and tissue specificity to
heterologous promoters (Poulsen and Chua, 1988). The
promoter regions of two of the five tomato rbcS genes
also show homology to the SSU301 nucleotide sequence
blocks shown in Figure 1. The expression of these two
tomato genes, in contrast to the other tomato rbcS genes,
does not decrease rapidly when tomato plants are transferred to the dark (Manzara and Gruissem, 1988). Similarly,
SSU911 expression decreases more rapidly than SSU301
expression when petunia plants are transferred to the dark
(Stayton et al., 1989). Whether there is any correlation
213
between the presence of the sequences homologous to
the - 2 8 5 to - 2 0 4 SSU301 fragment and the pattern of
gene expression in the light/dark experiments is currently
being investigated.
The region of the SSU301 promoter from -1 to -178
shows extensive regions of nucleotide sequence similarity
with the same regions of the other petunia rbcS genes
(Dean et al., 1985b). The only sequence homology within
this region, which is conserved in all rbcS genes from
dicotyledonous plant species so far examined, is a 14-bp
region termed box II (Kuhlemeier et al., 1987b). Replacing
this region in SSU911 with the equivalent region from the
SSU301 gene did not affect the level of SSU911 expression, demonstrating the absence of sequence elements
within this region that contribute to the quantitative differences in expression of SSU301 and SSU911. Box II is
believed to function as a negative regulatory element in
the pea rbcS genes and possibly it functions similarly in
the petunia rbcS genes. It clearly does not contribute to
the differential expression of the petunia genes.
The SSU301 promoter element characterized here confers large quantitative differences to the expression of the
rbcS genes within this multi-gene family. Currently, we are
testing whether addition of the -285 to -204 SSU301
fragment influences the quantitative and qualitative
expression of heterologous promoters and whether all the
sequences within the -285 to - 2 0 4 fragment are required.
METHODS
Details of Cloning Procedures
Mutagenesis of the sSUgl 1 Gene
A 1.3-kb HindllI-Saclfragment containing the 5' region of SSU911
(515 bp), the 5'-untranslated leader region, and the first 810 bp
of coding region was cloned into pUC13 (Vieira and Messing,
1987). Two nucleotides, TC, were introduced using oligonucleotide site-directedmutagenesis(Kunkel, 1985) into the 5' promoter
region at position -198 (Figure 1) to create a BamHI restriction
site. The resulting plasmidwas termed pSSU919.
Addition of the -1300 to -178 SSU301 Fragment
A DNA fragment containing the nucleotide sequence located
between -1300 and -178 from the transcription start site of
SSU301 was cloned after partial digestion with Ddel, a fill-in
reaction using DNA polymerase I Klenow fragment and a subsequent EcoRI Digestion into pUC118 (Vieira and Messing, 1987)
digested with EcoRl+Smal. Sequence analysiswas used to confirm the identity of the correct clone, which was termed
pSSU3024. The fragment was removed from the pUC vector by
EcoRl+BamHI digestion, made blunt-endedwith DNA polymerase
214
The Plant Cell
I Klenow fragment, cloned in both orientations into pSSU919
digested with BamHI, and blunt-ended with DNA polymerase I
Klenow fragment (constructions 3 and 4, Figure 2).
Addition of the - 2 8 5 to -178 and -291 to - 2 0 4 SSU301
Fragments
The plasmid pSSU3024 was transformed into the methylation
minus strain GMl19. A fragment containing the nucleotide sequence located between -285 and -178 from the transcription
start site of SSU301 was isolated using TaqI-BamHI digestion and
cloned into pUC118 digested with Accl and BamHI. The fragment
was removed from the pUC vector by Hindlll+BamHI digestion,
made blunt-ended with DNA polymerase I Klenow fragment,
cloned in both orientations into pSSU919 digested with BamHI,
and blunt-ended with DNA polymerase I Klenow fragment (constructions 6 and 7, Figure 2).
Both strands of the nucleotide sequence extending from -291
to -204 were synthesized, one using an Applied Biosystems
381A DNA synthesizer and the other using a Pharmacia DNA
synthesizer. The synthesized oligonucleotides contained two mutations in their sequence (indicated on Figure 1); CT was added
at position -227 and there was a C to G substitution at -254.
The synthesized sequence was 5'-GATCGTTACCTCGATCACACATTCATATCCACTTCCTACTCGATATCGGATGAGATAAGATTACTAAGCTTGCTTCCACGTGGCACCTCCA'I-r-3'. The complementary oligonucleotides were annealed and cloned into
pUC118 digested with BamHl. The fragment was removed from
the pUC vector by Smal+Xbal digestion, made blunt-ended with
DNA polymerase I Klenow fragment, cloned into pSSU919 digested with BamHI, and made blunt-ended with DNA polymerase
I Klenow fragment (construction 8, Figure 2).
Addition of the ocs Coding Region Fragments
A 1.1-kb HindllI-Pvull fragment carrying the octopine synthase
(deGreve et al., 1983) (ocs) coding region, 25 bp of SSU301 5'untranslated leader sequence, and 11 bp of ocs 3'-untranslated
tail region was made blunt-ended with DNA polymerase I Klenow
fragment, cloned into pSSU919 digested with BamHI, and made
blunt-ended with DNA polymerase I Klenow fragment. The ocs
coding region was oriented in the opposite orientation to the
SSU911 coding region (construction 5, Figure 2).
A 108-bp HinclI-EcoRI fragment (470 to 578 bp from the
translation initiation codon) from the ocs coding region was bluntended and cloned into pSSU919 digested with BamHI, and made
blunt-ended with DNA polymerase I Klenow fragment (construction 9, Figure 2).
Replacement of SSU911 Sequences (-198 to +20) with Those
of SSU301 (-182 to +55)
The DNA fragment containing the nucleotide sequence extending
from -182 to +55 (an Ncol site is located at the translation
initiation codon at +55) of the SSU301 gene was digested with
Ddel, made blunt-ended with DNA polymerase I Klenow fragment,
and digested with Ncol. The fragment was cloned into pUC120
(Vieira and Messing, 1987) digested with Ncol and Smal. The
fragment was then removed from the pUC vector as a BamHINcol fragment and used to replace the BamHI-Ncol (-198 to +20)
fragment from pSSU919 (construction 10, Figure 2).
Any BamHI restriction sites in the resulting clones generated in
the above five steps were removed by digestion, DNA polymerase
I Klenow fragment treatment, and religation. The entire HindlllSacl fragment containing the 5' region of the SSU911 gene and
810 bp of coding region with the vadous additions or substitutions
from SSU301 were cloned into a plasmid digested with HindllSacl. This plasmid contained the remainder of the SSU911 coding
region and 1.8 kb of 3'-flanking DNA terminating with a BamHI
restriction site. Schematic illustrations of all the constructions are
shown in Figure 2.
The intact SSU911 gene (construction 1, Figure 2), the ATGexchange fusion containing the 5' region of SSU301, and the 3'
region of SSU911 (construction 2, Figure 2), and all the constructions described above (constructions 3 to 10, Figure 2) were
linearized at the unique BamHI site at 1.8 kb 3' of the SSU911
gene. They were then cloned into the BamHI site of the Agrobacterium binary vector pAGS140 (Dean et al., 1988). The same
orientation of the gene and pUC sequences in the binary vector
was chosen for all 10 constructions.
Plant Transformation
The binary vector constructions were mobilized into the A. tumefaciens strain LBA4404/pAL4404 (Hoekema et al., 1983) by triparental mating (Figurski and Helinski, 1979). The stability of the
construction in Agrobacterium was examined by rescuing the
binary vector plasmid in Escherichia coil HB101 from a total DNA
preparation of Agrobacterium DNA. The Agrobacterium strains
were used to transform Nicotiana tabacum cv.W38 using the leafdisc transformation procedure (Horsch et al., 1985). After a 3-day
cocultivation, the leaf discs were transferred to shooting media
(MS media containing 0.1 mg/I NAA and 1 mg/I BAP), the bacteria
were counter-selected using 100 mg/I vancomycin, and the transformed plant cells were selected on 300 mg/I kanamycin. The
kanamycin-resistant shoots were rooted in MS media containing
100 mg/I kanamycin, transferred to soil, and, after 2 days at high
humidity in a growth chamber, transferred to the greenhouse.
Fifteen independently transformed tobacco plants for each construction were transferred to the greenhouse on the same day.
RNA Isolation and Analysis
RNA was isolated from 8-cm to 10-cm leaves from tobacco plants
25 days after transfer to the greenhouse as described previously
(Dean et al., 1985b). The expression of the introduced fusions
was analyzed using a primer extension assay using the 911T
oligonucleotide as described previously (Dean et al., 1987b).
ACKNOWLEDGMENTS
We thank Gary Warren and Jonathan Jones for critical reading of
the manuscript. We also thank Diane Bond-Nutter for performing
the tobacco tissue culture, Tom Lemieux and Cara Robinson for
care of the tobacco plants, and Connie Stephens, Joyce Hayashi,
and Rob Narberes for preparing the figures.
Received December 2, 1988.
Upstream Sequences Affect Expression Levels
REFERENCES
Dean, D., van den Elzen, P., Tamaki, S., Dunsmuir, P., and
Bedbrook, J. (1985a). Linkage and homology analysis divides
the eight genes for the small subunit of petunia ribulose-1, 5bisphosphate carboxylase into three gene families. Proc. Natl.
Acad. Sci. USA 82, 4964-4968.
Dean, C., van den Elzen, P., Tamaki, S., Dunsmuir, P., and
Bedbrook, J. (1985b). Differential expression of the eight genes
of the petunia ribulose bisphosphate carboxylase small subunit
multi-gene family. EMBO J. 4, 3055-3061.
Dean, C., van den Elzen, P., Tamaki, S., Black, M., Dunsmuir,
P., and Bedbrook, J. (1987a). Molecular characterization of the
rbcS multi-gene family of Petunia (Mitchell). Mol. Gen. Genet.
206, 465-474.
Dean, C., Favreau, M., Dunsmuir, P., and Bedbrook, J. (1987b).
Confirmation of the relative expression levels of the Petunia
(Mitchell) rbcS genes. Nucleic Acids Res. 15, 4655-4668.
Dean, C., Favreau, M., Tamaki, S., Bond-Nutter, D., Dunsmuir,
P., and Bedbrook, J. (1988). Expression of tandem gene
fusions in transgenic tobacco plants. Nucleic Acids Res. 16,
7601-7617.
Dean, C., Favreau, M., Bond-Nutter, D., Bedbrook, J., and
Dunsmuir, P. (1989). Sequences downstream of translation
start regulate quantitative expression of two Petunia rbcS
genes. Plant Cell 1,201-208.
DeGreve, H., Dhaese, P., Seurinck, J., Lemmers, M., van Montagu, M., and ScheU, J. (1983). Nucleotide sequence and
transcript map of the Agrobacterium tumefaciens Ti plasmid
encoded octopine synthase. J. Mol. Appl. Genet. 1,499-511.
Figurski, D., and Helinski, D. R. (1979). Replication of an origincontaining derivative of plasmid RK2 dependent on a plasmid
function provided in trans. Proc. Natl. Acad. Sci. USA 76, 16481652.
Hoekema, A., Hirsch, P. R., Hooykaas, P.J.J., and Schilperoot,
R.A. (1983). A binary plant vector strategy based on separation
of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303, 179-180.
Horsch, R.B., Fry, J.E., Hoffman, N.L., Eichholtz, D., Rogers,
S.G., and Fraley, R.T. (1985). A simple and general method for
transferring genes into plants. Science 227, 1229-1231.
Jones, J., Gilbert, D., Grady, K., and Jorgensen, R. (1987). TDNA structure and gene expression in petunia plants transformed by Agrobacterium tumefaciens C58 derivatives. Mol.
Gen. Genet. 207, 478-485.
Kuhlemeier, C., Green, P. J., and Chua, N.-H. (1987a). Regula-
215
tion of gene expression in higher plants. Annu. Rev. Plant
Physiol. 38, 221-257.
Kuhlemeier, C., Fluhr, R., Green, P.J., Chua, N.-H. (1987b).
Sequences in the pea rbcS-3A gene have homology to constitutive mammalian enhancers but function as negative regulatory
elements. Genes Dev. 1,247-255.
Kunkel, T.A. (1985). Rapid and efficient site-specific mutagenesis
without phenotypic selection. Proc. Natl. Acad. Sci. USA 82,
488-492.
Manzara, T., and Gruissem, W. (1988). Organization and expression of the genes encoding ribulose-1,5-bisphosphate carboxylase in higher plants. Photosynth. Res. 16, 117-130.
Morelli, G., Nagy, F., Fraley, R.T., Rogers, S.G., andChua, N.H. (1985). A short conserved sequence is involved in the lightinducibility of a gene encoding ribulose 1,5-bisphosphate carboxylase in higher plants. Nature 315, 200-204.
Nagy, F., Morelli, G,, Fraley, R.T., Rogers, S.G., and Chua, N.H.
(1985). Photoregulated expression of a pea rbcS gene in leaves
of transgenic plants. EMBO J. 12, 3063-3068.
Odell, J.T., Nagy, F., and Chua, N-H. (1987). Variability in 35S
promoter expression between independent transformants. In
Plant Gene Systems and Their Biology, J. Key and L. Mclntosh,
eds (New York: Alan R. Liss), Vol. 62, pp. 321-329.
Poulsen, C., and Chua, N.-H. (1988). Dissection of 5' upstream
sequences for selective expression of the Nicotiana plumbaginifolia rbcS-SB gene. MoI. Gen. Genet. 214, 16-23.
Poulsen, C., Fluhr, R., Kauffman, J. M., Boutry, M., and Chua,
N.-H. (1986). Characterization of an rbcS gene from Nicotiana
plumbaginifolia and expression of an rbcS-CAT chimeric gene
in homologous and heterologous nuclear background. Mol.
Gen. Genet. 205, 193-200.
Stayton, M., Brosio, P., and Dunsmuir, P. (1989). Photosynthetic
genes of Petunia are differently expressed during the diurnal
cycle. Plant Physiol. 89, in press.
Sugita, M., Manzara, T., Pichersky, E., Cashmore, A., and
Gruissem, W. (1987). Genomic organization, sequence analysis
and expression of all five genes encoding the small subunit of
ribulose-l,5-bisphosphate carboxylase/oxygenase from tomato. Mol. Gen. Genet. 209, 247-256.
Timko, M. P., Kausch, A.P., Castresana, C., Fassler, J., Herrera-Estrella, L., van den Broeck, G., van Montagu, M.,
Schell, J., and Cashmore, A. (1985). Light regulation of plant
gene expression by an upstream enhancer-like element. Nature
318, 579-582.
Vieira, J., and Messing, J. (1987). Production of single-stranded
plasmid DNA. Methods Enzymol. 153, 3-11.
Sequences 5' to translation start regulate expression of petunia rbcS genes.
C Dean, M Favreau, J Bedbrook and P Dunsmuir
Plant Cell 1989;1;209-215
DOI 10.1105/tpc.1.2.209
This information is current as of June 18, 2017
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw153229
8X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY