Download Transcription Worksheet

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Microevolution wikipedia , lookup

MicroRNA wikipedia , lookup

Transfer RNA wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

DNA wikipedia , lookup

DNA vaccination wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Nucleosome wikipedia , lookup

Genealogical DNA test wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Holliday junction wikipedia , lookup

Genomics wikipedia , lookup

RNA interference wikipedia , lookup

History of genetic engineering wikipedia , lookup

DNA polymerase wikipedia , lookup

RNA world wikipedia , lookup

Molecular cloning wikipedia , lookup

SNP genotyping wikipedia , lookup

Epigenomics wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Point mutation wikipedia , lookup

Expanded genetic code wikipedia , lookup

RNA silencing wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Non-coding DNA wikipedia , lookup

Polyadenylation wikipedia , lookup

Gene wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA supercoil wikipedia , lookup

RNA wikipedia , lookup

Helitron (biology) wikipedia , lookup

RNA-Seq wikipedia , lookup

History of RNA biology wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Genetic code wikipedia , lookup

Non-coding RNA wikipedia , lookup

RNA-binding protein wikipedia , lookup

Replisome wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Messenger RNA wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Primary transcript wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
WS 8 – 3: Transcription
Name_________________________________________________
Write the answer to each question in the blank provided.
1. What is the enzyme that is important for the process of transcription?______________________________
2. In DNA, what is the sugar called?___________________________________________________________
3. What is a three nucleotide sequence of mRNA called?___________________________________________
4. What is the process when messenger RNA is made from a molecule of DNA?________________________
5. What type of RNA carries the DNA information to the cytoplasm?_________________________________
6. What part of the cell does transcription take place?______________________________________________
7. In RNA, the sugar is called what?___________________________________________________________
8. What does each codon represent?____________________________________________________________
9. Type of RNA that makes up ribosomes?______________________________________________________
10. type of RNA that brings amino acids to the ribosomes?__________________________________________
For the questions below, use the DNA molecule below.
Strand #1
ACGTTGCACGTAGCATAACCGGTTTAGACG
11. On the line above, synthesize the complementary DNA strand using strand #1 above.
12. On the line below, write the complementary mRNA base sequence to strand #1.
13. How many codons are in the mRNA molecule above?___________________________________________
14. How many amino acids would be coded for in the mRNA molecule above?__________________________
Strand #2
ACGATGCACGGAGCCTAGCAGGTGTAGAA A
15. On the line above, synthesize the complementary DNA strand using strand #1 above.
16. On the line below, write the complementary mRNA base sequence to strand #1.
17. How many codons are in the mRNA molecule above?___________________________________________
18. How many amino acids would be coded for in the mRNA molecule above?__________________________
19. The m in mRNA stands for what? What is the function of mRNA?
20. Compare and contrast DNA and RNA.
Use the diagram below to answer the questions.
21. What does structure #1 represent?__________________________________________________________
22. What does structure #2 represent?__________________________________________________________
23. What is the DNA code for aspartic acid?______________________________________________________
24. What is being described in process A? _________________________________________________
25. What part of the cell does it take place?_________________________________________________