* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription Worksheet
Microevolution wikipedia , lookup
Transfer RNA wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Holliday junction wikipedia , lookup
RNA interference wikipedia , lookup
History of genetic engineering wikipedia , lookup
DNA polymerase wikipedia , lookup
Molecular cloning wikipedia , lookup
SNP genotyping wikipedia , lookup
Epigenomics wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Point mutation wikipedia , lookup
Expanded genetic code wikipedia , lookup
RNA silencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Helitron (biology) wikipedia , lookup
History of RNA biology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
RNA-binding protein wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
WS 8 – 3: Transcription Name_________________________________________________ Write the answer to each question in the blank provided. 1. What is the enzyme that is important for the process of transcription?______________________________ 2. In DNA, what is the sugar called?___________________________________________________________ 3. What is a three nucleotide sequence of mRNA called?___________________________________________ 4. What is the process when messenger RNA is made from a molecule of DNA?________________________ 5. What type of RNA carries the DNA information to the cytoplasm?_________________________________ 6. What part of the cell does transcription take place?______________________________________________ 7. In RNA, the sugar is called what?___________________________________________________________ 8. What does each codon represent?____________________________________________________________ 9. Type of RNA that makes up ribosomes?______________________________________________________ 10. type of RNA that brings amino acids to the ribosomes?__________________________________________ For the questions below, use the DNA molecule below. Strand #1 ACGTTGCACGTAGCATAACCGGTTTAGACG 11. On the line above, synthesize the complementary DNA strand using strand #1 above. 12. On the line below, write the complementary mRNA base sequence to strand #1. 13. How many codons are in the mRNA molecule above?___________________________________________ 14. How many amino acids would be coded for in the mRNA molecule above?__________________________ Strand #2 ACGTTGCACGTAGCATAACCGGTTTAGACG 15. On the line above, synthesize the complementary DNA strand using strand #1 above. 16. On the line below, write the complementary mRNA base sequence to strand #1. 17. How many codons are in the mRNA molecule above?___________________________________________ 18. How many amino acids would be coded for in the mRNA molecule above?__________________________ 19. The m in mRNA stands for what? What is the function of mRNA? 20. Compare and contrast DNA and RNA. Use the diagram below to answer the questions. 21. What does structure #1 represent?__________________________________________________________ 22. What does structure #2 represent?__________________________________________________________ 23. What is the DNA code for aspartic acid?______________________________________________________ 24. What is being described in process A? _________________________________________________ 25. What part of the cell does it take place?_________________________________________________