Download 6CDE Transcription and Translation

Name: _____________________________________ Date: __________ Class: ______
Review
B.6CDE: Transcription and Translation
B.6C: Explain the purpose and process of transcription and translation using models of DNA
and RNA. Supporting Standard
B.6D: Recognize that gene expression is a regulated process. Supporting Standard
B.6E: Identify and illustrate changes in DNA and evaluate the significance of these
changes. ✪ Readiness Standard
1. Transcription is the process of synthesizing RNA from DNA (in the nucleus in
eukaryotic cells); this is gene expression. For transcription to occur, the DNA
helix unzips itself, and the antisense strand of the DNA is transcribed into mRNA.
2. Translation is the process of synthesizing proteins from RNA. The mRNA from
transcription carries genetic information from the nucleus to the ribosome for
protein synthesis. RNA catalyzes translation and reads the mRNA at ribosomes to
link amino acids into protein.
3. Mutations are spontaneous changes in DNA. Mutations can be simple base-pair
substitutions like point mutations and immediately change a gene sequence.
Insertion or deletion mutations result in a frame-shift and may result in an
incorrect amino acid sequence in the synthesized protein.
4. Gene expression is a regulated process, and most of DNA is made up of
regulatory sequences, not genes. Genes can be turned on and off (expressed or
not expressed). Transcription and translation occur only when cells need the
gene product; cells don’t make all possible proteins all of the time.
Vocabulary
anticodon, frameshift mutation, gamete, gene expression, genetic disorder, messenger
RNA, mutagen, peptide bond, point mutation, ribosomal RNA, RNA polymerase,
transcription, transfer RNA, translation
Fundamental Questions
Use the Key Concepts information as well as the information in your Stemscopedia
beginning on page 41 to answer the fundamental questions below.
1. What is the purpose of transcription of DNA?
2. What is the purpose of translation of RNA?
3. How do changes in DNA affect the production of amino acids?
Analysis
Complete the following in the space provided.
1) Describe the process of transcription.
2) Transcribe the DNA strand below into mRNA then translate it into a sequence of amino
acids.
DNA:
GTACGCGTATACCGACATTC
mRNA:
Codons:
Amino Acids:
3) Explain the relationship between biodiversity and mutations.
4) Relate mutations to evolution.