Download Genetics Notes.notebook

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Human genome wikipedia , lookup

DNA wikipedia , lookup

Oncogenomics wikipedia , lookup

Zinc finger nuclease wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Medical genetics wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

DNA repair wikipedia , lookup

DNA profiling wikipedia , lookup

Genomic library wikipedia , lookup

Frameshift mutation wikipedia , lookup

Nutriepigenomics wikipedia , lookup

SNP genotyping wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

Genetic engineering wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

DNA polymerase wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Nucleosome wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Designer baby wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Genomics wikipedia , lookup

Gene wikipedia , lookup

Mutagen wikipedia , lookup

DNA vaccination wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Mutation wikipedia , lookup

Genealogical DNA test wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Genome editing wikipedia , lookup

Replisome wikipedia , lookup

Primary transcript wikipedia , lookup

Epigenomics wikipedia , lookup

Molecular cloning wikipedia , lookup

Microsatellite wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Non-coding DNA wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

DNA supercoil wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Helitron (biology) wikipedia , lookup

Point mutation wikipedia , lookup

History of genetic engineering wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Microevolution wikipedia , lookup

Transcript
Genetics Notes.notebook
Warm­up: Discuss with your table,what is heredity? March 05, 2015
Clasp your hands without thinking about it. Which thumb is on top?
Look at your hand. Is your pinky finger bent in towards your ring finger?
Do you have dimples?
Do you have a cleft chin?
Does your earlobe hang free or is it attached to your face at the bottom?
Can you roll your tongue?
Do you have a widows peak?
Do you have hitchhikers thumb?
Oct 4­10:23 AM
.
Oct 4­10:29 AM
Your DNA is an macromolecule ­ it is a nucleic acid
The building blocks of DNA are nucleotides:
DNA structure
Nucleotides pair up using base­pairing rules.
The shape of a DNA molecule is called a double helix
https://www.youtube.com/watch?v=09FWJbdcNlA
Oct 7­9:36 AM
DNA Molecule
Pick 4 colors to represent the bases ­ color each base accordingly
http://www.youtube.com/watch?v=ubq4eu_TDFc
Oct 4­10:49 AM
Warm­up: Describe how DNA is structured. Try to do it without looking at your notes!
While you are coloring, I am going to come around and talk to you about science next year so I can make recommendations to the schedulers.
Feb 25­10:43 AM
Feb 26­7:33 AM
1
Genetics Notes.notebook
March 05, 2015
Your traits determined by your genes. So....
what are genes?
http://www.youtube.com/watch?v=5MQdXjRPHmQ
DNA Organization
Each molecule of DNA, containing your genes, is wound tightly into a structure called a chromosome
Oct 4­10:39 AM
Feb 24­2:01 PM
DNA modeling
DNA Models
1. Describe the general structure of DNA (in your own words!) What is the official name of this shape?
2. What two molecules make the backbone of DNA? (these are the "hand­holds" of the ladder)
3. What bases always pair together?
4. How is your model the same as other peoples? How is it different?
Feb 25­8:16 AM
Think/Pair/Share: DNA has the same double helix structure in all living organisms. However, we know that a plant, mammal and bacteria must have different genes in their DNA to result in the very different characteristics of these different organisms. What is different in the DNA of these different organisms?
Oct 7­10:04 AM
Check­in Quiz:
What 4 chemicals (just the letters) make up your DNA? What are the base­pairing rules?
What is the relationship between genes and DNA?
Oct 10­9:50 AM
Oct 4­11:54 AM
2
Genetics Notes.notebook
March 05, 2015
Trade with a neighbor to correct.
What 4 chemicals (just the letters) make up your DNA? What are the base­pairing rules?
What is the relationship between genes and DNA?
Oct 3­7:45 AM
Feb 27­1:43 PM
1. DNA Extraction!
2.
What do you think your DNA will look like? Why?
3.
Quiz on Monday!
I can describe the structure of DNA and the relationship between DNA, genes and chromosomes.
4.
http://www.youtube.com/watch?v=vPGKv53zSRQ
5.
I can describe the process of DNA replication.
6.
7.
8.
Feb 27­1:18 PM
Have one person get the following things and bring them to your table:
Oct 15­10:31 AM
Bioengineering
http://www.youtube.com/watch?v=ovV7v2XYJAI
1. Strawberry in a plastic bag
2. Paper towel
3. Wooden stick
How was this discovered?
http://www.youtube.com/watch?v=d7ET4bbkTm0
4. Small beaker
Oct 21­11:17 AM
Feb 20­9:22 AM
3
Genetics Notes.notebook
Warm­up:
What is a chromosome composed of?
March 05, 2015
Think/Pair/Share: If a DNA strand is 20% Adenine, what percentage is Thymine? What percentage is Cytosine?
Draw and label the following picture in your notebook.
http://www.youtube.com/watch?v=9kQpYdCnU14
Oct 8­9:22 AM
Warm­up: Take out a sheet of paper and a writing utensil, put everything else away.
Oct 8­9:39 AM
Warm­up: We all start out as one cell. What has to happen for all of your cells to have the same DNA?
Oct 3­7:44 AM
Oct 22­8:34 AM
We all start out as one cell. What has to happen for all of your cells to have the same DNA?
DNA Replication
Proteins do the work of replication.
Helicase
How does the DNA know which
base to add to the new strand?
Polymerase
http://www.youtube.com/watch?v=zdDkiRw1PdU
http://www.youtube.com/watch?v=zdDkiRw1PdU
Oct 7­10:03 AM
Feb 26­9:46 AM
4
Genetics Notes.notebook
Think/Pair/Share:
If this is a template strand of DNA
AAT GTG CCA GGG TGT ATT
What would the new strand be?
March 05, 2015
Modeling Replication questions:
1. Why is this type of replication called "semi­
conservative"? (semi=half, conservative=save)
2. Mistakes in DNA replication lead to mutations, which may or may not be harmful. How does semi­conservative replication help prevent mutations during DNA replication?
Oct 8­9:55 AM
Think/Pair/Share: Where is the "genetic code" stored in the DNA molecule?
Feb 26­9:51 AM
Warm­up
If this is a template strand of DNA
AATGTGCCA
What would the new strand be?
Why must the DNA replicate?
Oct 8­9:51 AM
T/P/S: Describe the relationship between DNA, genes and chromosomes.
Oct 8­9:52 AM
DNA Replication Reading and Questions.
Use the reading to answer questions 1­10. Sep 29­8:10 AM
Oct 8­9:50 AM
5
Genetics Notes.notebook
March 05, 2015
Karyotypes
Warm­up
What is the relationship between DNA, genes and chromosomes?
Chart used by geneticists to diagnose chromosomal abnormalities
Oct 11­11:41 AM
Oct 11­11:41 AM
Reading a karyotype
Number Down Syndrome ­ Trisomy 21
Sex
Feb 27­9:44 AM
Turner's Syndrome XO
Female ­ no Y chromosome
Oct 11­12:28 PM
Oct 11­12:31 PM
Klinefelter's Syndrome (XXY ­ Extra X chromosome)
Male
Oct 11­12:04 PM
6
Genetics Notes.notebook
Edward's Syndrome (Trisomy 18)
March 05, 2015
Make your own karyotype
Oct 11­12:04 PM
Feb 27­9:53 AM
+
Warm­up
What are the two major proteins involved in DNA replication?
What is the role of each protein?
Warm­up:
What is a karyotype? Describe what it is and why you might use one.
Oct 9­10:53 AM
Oct 14­11:18 AM
Steps in DNA fingerprinting
Warm­up: What are your chromosomes made of? Where are they stored?
1. Collect a DNA sample ­ must have cells!
2. Use a process called PCR to make the DNA replicate many times
3. Cut the samples with restriction enzymes
4. Sort pieces by length using gel electrophoresis
Oct 15­10:28 AM
Oct 22­9:54 AM
7
Genetics Notes.notebook
Warm­up: What are the steps to DNA fingerprinting?
Why does the name Polymerase Chain Reaction (PCR) make sense?
March 05, 2015
Warm­up
How can DNA fingerprinting be used to match a suspects DNA to a DNA sample taken from a crime scene?
http://www.youtube.com/watch?v=2KoLnIwoZKU
Oct 22­2:01 PM
Oct 24­10:38 AM
DNA fingerprinting
Warm­up: Where in the DNA is the genetic code stored? How is your DNA different from everyone else's DNA?
Complete the DNA replication simulation (part I)
Run your 'electrophoresis' test (part II)
http://www.youtube.com/watch?v=ZxWXCT9wVoI
Oct 22­9:50 AM
Forensics: DNA Fingerprinting
Every individual (except identical twins) has unique DNA.
The differences are found in between our genes ­ in "non­coding" DNA.
Mar 4­8:54 AM
DNA fingerprinting simulation
In DNA fingerprinting, the DNA is cut into several fragments and organized according to fragment size
We can use these differences to compare DNA and find out who a DNA sample came from.
http://www.youtube.com/watch?v=ZxWXCT9wVoI
Oct 22­8:35 AM
Mar 4­9:12 AM
8
Genetics Notes.notebook
DNA Fingerprinting Analysis Questions
Answer the following questions in COMPLETE SENTENCES! 1. Did anyone have exactly the same pattern of bands as someone else? Why or why not?
2. Do you think someone should be convicted solely on DNA evidence?
March 05, 2015
Warm­up discussion ­ each table must share out their answers!
Generally, DNA libraries only store information about certain fragments of DNA ­ not a person's full genetic code. It is exceedingly useful in identifying offenders in situations where a DNA sample is collected from a crime scene. On the other hand, the existence of such a library may violate privacy rights.
1. Should governments maintain a DNA library? Why or why not?
2. How might a DNA library be misused or abused by the police or government?
Oct 24­10:19 AM
Review your test answers! Correct the ones you got wrong and write a one sentence explanation of your reason for picking the wrong answer and why you now know the right one.
Mar 5­9:24 AM
Oct 24­10:22 AM
DNA Fingerprinting Case Studies
http://www.youtube.com/watch?v=LkuKBflUoJE
Mar 5­9:24 AM
Warm­up: Describe the relationship between DNA, genes and chromosomes.
Biochem Tests
& POGIL
Mar 6­9:18 AM
Oct 6­12:15 PM
9
Genetics Notes.notebook
March 05, 2015
Warm­up
Why is the order of the bases (ATCG) in DNA important?
Protein Review
What are the building blocks of proteins?
What biological functions do proteins perform?
http://www.youtube.com/watch?v=o3yQZp5Rs­o
Oct 7­10:20 AM
How does DNA determine our traits?
Genes provide instructions for making proteins
Proteins determine our traits
Oct 23­10:15 AM
DNA Review Warm­up:
1. What is the relationship between DNA, genes and chromosomes?
2. What two proteins are involved in DNA replication? What are their roles?
3. Explain the process of DNA replication in your own words.
http://www.youtube.com/watch?v=o3yQZp5Rs­o
Oct 23­9:46 AM
Oct 15­10:42 AM
What do our genes code for?
http://www.youtube.com/watch?
v=zwibgNGe4aY&list=PLwck7c7ztQNuy8Ps7Wkc1gywm9eVgST9s
Going from DNA to proteins is a two step process
1. DNA is used as a template to make RNA ­ Transcription
2. RNA is read as instructions for a protein ­ Translation
Oct 9­10:54 AM
Oct 23­9:52 AM
10
Genetics Notes.notebook
March 05, 2015
Step 1 ­ Transcription: using DNA as a template So what is RNA?
to make mRNA
Oct 23­9:55 AM
Oct 23­9:54 AM
http://www.youtube.com/watch?
v=5MfSYnItYvg&list=TLXpOI4­6JY4­3MsA_a8geOtV8KOA56lig
Three step process of transcription
A. Practice: Transcribe this DNA into RNA
B.
AAT GTG CCA CGG TGG TAC
C.
http://www.youtube.com/watch?v=5MfSYnItYvg
Oct 23­10:05 AM
Oct 23­10:06 AM
Take 10 minutes to finish your POGIL
Warm­up: Using complete sentences and as many vocab words as you can, compare and contrast replication and transcription.
Mar 7­9:47 AM
You must complete the questions as a group ­ that means everyone needs to stay on task! One sheet will get turned in for everyone to get credit ­ I will decide which member turns it in!
Oct 3­8:17 AM
11
Genetics Notes.notebook
March 05, 2015
Step 2 ­ Translation: using mRNA as a template to make a protein
Two step process of translation:
A. B. `
http://www.youtube.com/watch?v=8dsTvBaUMvw
http://www.youtube.com/watch?v=8dsTvBaUMvw
Oct 23­10:28 AM
Oct 23­10:38 AM
How do we know which amino acids to add?
Practice ­ If I have this strand of RNA UAG GCA UUA CUG GUG
How many codons?
How many amino acids would be added to a protein?
Oct 23­10:37 AM
Put it all together....
Transcribe this DNA into mRNA
CTG GGT ATC GTA GCT TTC ACT
AUG
GGG
CUU
UGG
Oct 23­10:45 AM
Transcribe this gene into mRNA. ACT TGA TTG ACG ATG GTC
How do you know which mRNA base will pair with each DNA base?
Translate your mRNA into a protein (amino acid chain)
Mar 7­9:33 AM
Why did I write it in 3 letter chunks?
Oct 9­11:49 AM
12
Genetics Notes.notebook
March 05, 2015
Draw this table in your note book and fill out as much as you can with your table. Replication
Transcription
Translation
Purpose
Create a poster with pictures that explains protein synthesis using only the following terms:
DNA, mRNA, tRNA, proteins, transcription, translation, nucleotide
Where does
it occur?
Whole Everyone in your group needs to be able to explain the process!
molecule?
Result
Mar 6­9:34 AM
Mar 5­8:37 AM
Protein Synthesis Activity
Take 15 minutes to finish up your discussions/answer questions about bear reintroduction. When you finish, get a review sheet from Ms. Canney.
Mar 5­10:54 AM
DNA: ACT TGC ATC TGT ACT TGC TTC
Oct 8­10:33 AM
Review worksheet ­ you have the rest of the hour to work on it. If you finish have me check it, if not, it is homework!
mRNA:
Protein:
Oct 9­12:21 PM
Mar 7­11:22 AM
13
Genetics Notes.notebook
Warm­up: Copy these learning targets into your notebook
March 05, 2015
Central Dogma of Biology
I can use words and phrases to differentiate between the processes of photosynthesis and respiration in terms of energy flow, reactants and products.
I can explain the relationship between DNA, genes and chromosomes.
I can use a karyotype and forensic techniques to compare DNA samples.
I can describe the process of DNA replication and the role of DNA and RNA in protein synthesis.
Oct 29­11:14 AM
Oct 23­10:09 AM
Warm­up:
Summarize in a few sentences what we learned about on Friday. Try to do it without your notes. Use as many vocab words as you can!
Take out your lab and look it over for any last minute questions. If you have not done so, write your hypothesis!
Take out the worksheet so I can check it!
Oct 28­11:23 AM
Mar 10­2:11 PM
Warm­up: Summarize with your table what we talked about yesterday.
http://www.youtube.com/watch?v=d7ET4bbkTm0
Oct 4­11:13 AM
Feb 24­2:13 PM
14
Genetics Notes.notebook
March 05, 2015
Warm­up
12 pt. font
2 page minimum
• In your notebook write: THE CAT ATE THE RAT
>
Change one letter in the sentence
>
Did it change the meaning? Could you still understand it?
Due Sunday night
Feb 24­2:12 PM
The rest of the quarter.....
Nov 4­8:21 AM
Can we read mRNA?
All make up tests must be done by next Friday
We will review for two days during finals week, then take a cumulative (everything we've covered this quarter) final
Oct 21­12:10 PM
Oct 23­10:43 AM
Warm­up: Transcribe this DNA into RNA
CAC GTA GAC TGA GGA CTC
Now translate the mRNA into a string of amino acids (protein) using your codon chart.
..........................................................................................
Transcribe this DNA into RNA
CAC GTA GAC TGA GGA CAC
Translate the mRNA into a protein.
Mar 11­9:38 AM
Mar 12­8:43 AM
15
Genetics Notes.notebook
March 05, 2015
What is a mutation?
I can analyze the effect of DNA mutations (deletions, insertions, rearrangements and substitutions) on protein synthesis.
Mar 11­9:35 AM
How common are mutations?
Nov 4­8:26 AM
Types of Gene Mutations
1. Substitution
2. Insertion
3. Deletion
Nov 4­8:24 AM
Practice transcribing and translation DNA with mutations
Oct 10­10:31 AM
Nov 4­8:39 AM
Warm­up: Insertions and deletions tend to be more harmful than substitutions, use your knowledge of mutations to explain why.
Oct 10­1:48 PM
16
Genetics Notes.notebook
Genetic Mutations
March 05, 2015
Gene vs. Chromosome
Learning Targets
• I can analyze the effect of DNA mutations on
protein synthesis.
Nov 4­8:22 AM
What are the effects of mutations?
Mar 11­9:55 AM
Genetic vs. Infectious disease
Nov 4­8:26 AM
Warm­up:
What is the relationship between transcription and translation? Can one exist without the other? Explain your answer.
Mar 12­8:39 AM
Sickle Cell Anemia
http://www.youtube.com/watch?v=wzoWRKj7RoQ
Mar 12­9:13 AM
Mar 11­9:41 AM
17
Genetics Notes.notebook
Warm­up: Explain how a change in the DNA causes a disease like sickle cell or Tay Sachs.
March 05, 2015
Think/Pair/Share
Mutations are not rare. Explain why we don't see more physical changes in populations.
Mar 13­8:47 AM
Types of Mutations
>
1. Gene mutations:
>
2. Chromosomal mutations:
Mar 12­8:40 AM
• THE CAT ATE THE RAT
>
Original Gene
• GHE CAT ATE THE RAT
>
What type of mutation is this?
• THA ECA TAT ETH ERA T
>
Nov 4­8:30 AM
Chromosomal Mutations
What type of mutation is this?
Nov 5­8:24 AM
Silent Mutations
Insertion
Deletion
Inversion
Mar 12­8:34 AM
Mar 13­9:03 AM
18
Genetics Notes.notebook
Warm­up
Explain why an insertion mutation is more harmful than a substitution mutation. Use as much vocab as you can!
March 05, 2015
How can genetic material be altered?
• Natural changes:
• Artificial changes:
Take out Mutation worksheet for me to check.
Mar 13­9:09 AM
Mutagens
Nov 5­8:27 AM
What can mutations cause?
• Chemical mutagens:
Physical mutagens:
Nov 5­8:37 AM
Warm­up: What is a genetic mutation? What is the result of a mutation?
Nov 5­9:00 AM
Genetic mutation is the only source of variation in a population
Rock Pocket Mouse
http://www.youtube.com/watch?v=wrTXvrKBlbc
Oct 20­10:23 AM
Nov 5­11:57 AM
19
Genetics Notes.notebook
Exit ticket: Explain why the dark fur mutation became so widespread in the population of mice.
Mar 14­9:40 AM
March 05, 2015
Warm­up
• How can a mutation
cause a change in a
trait?
Nov 6­9:32 AM
Warm­up
Normal gene: •
Mutated gene:
AGCTATATGGCTACCTATTA
• AGCTATATGGCTAGGTATTA
What type of mutation is this?
Warm­up: We have discussed several things that are caused by mutations. Describe 2 of them.
• How can a mutation cause a change
in a trait?
Nov 5­9:27 AM
Mar 17­9:47 AM
Cancer is uncontrolled cell growth
On a sheet of paper with your table create a KWL Chart for Cancer
Oct 21­12:12 PM
Oct 21­12:13 PM
20
Genetics Notes.notebook
March 05, 2015
Exploring Mutation
Exploring Cancer
Activity
Oct 21­12:18 PM
Mar 17­8:31 AM
Genetics is the study of how traits are passed from a parent to an offspring (heredity).
Title your notebook page
Gregor Mendel is the "Father of Genetics"
Austrian monk who studied pea plants in the mid­1800s
Genetics Vocabulary Many of his observations became rules that are still useful in modern genetics
In my own words....
Definition
http://www.youtube.com/watch?v=GTiOETaZg4w
Use it in a sentence OR Picture/sketch
trick to help remember it
Allele
heterozygous
homozygous
recessive
dominant
monohybrid cross
gene
genetics
http://www.youtube.com/watch?v=0vAAf4g5iF8
Oct 4­10:46 AM
Oct 7­9:45 AM
Warm­up
In a sentence or two, describe what the reading we used yesterday was about.
What new vocabulary words do you remember?
Warm­up
Take 15 minutes to finish vocabulary list from yesterday. You can look at the questions if you finish early ­ we will do them together after the 15 minutes.
Allele
homozygous
monohybrid cross
genetics
Nov 7­11:15 AM
heterozygous
dominant
gene
recessive
Nov 7­11:17 AM
21
Genetics Notes.notebook
March 05, 2015
What is the P generation? What is the F1 generation?
What is the difference between a gene and an allele?
In figure 11­3, what is the dominant shape of the pea pod? How do you know?
Brown eyes are dominant to blue eyes. A person receives the allele for brown eyes from one parent and blue eyes from the other. Allele
homozygous
heterozygous
gene
monohybrid cross
dominant
recessive
genetics
Is this person heterozygous or homozygous? Will their eyes be blue or brown? How do you know?
Nov 7­11:19 AM
Warm­up: How many copies of a dominant allele must an organism have to show the dominant trait? How many recessive alleles must they have to show the recessive trait?
Nov 8­11:25 AM
Two new vocabulary words....
Smiley Face Genetics
Nov 7­1:56 PM
Sickle Cell Case Study
Nov 11­11:15 AM
How can we predict the outcome of monohybrid crosses?
Heterozygous or homozygous =
Example: Punnett Squares
Observable traits = Example:
Nov 11­11:14 AM
Nov 11­11:19 AM
22
Genetics Notes.notebook
Warm­up: Write a sentence with each of the following words ­ be prepared to share! :) Phenotype
Allele
Heterozygous
March 05, 2015
Practice: What are the phenotypes for the trait eye color? What are the possible genotypes for each phenotype?
Brown = B
Blue = b
Recessive
Nov 12­9:00 AM
Yellow pea pods are dominant over green pea pods. A heterozygote is crossed with a homozygous dominant plant. Create a punnett square.
Nov 12­9:03 AM
One fruit fly is heterozygous for red eyes and the other is homozygous recessive with white eyes. 1. What is the dominant allele?
2. What are the genotypes of these two flies?
3. Create a punnett square, what would you expect their offspring to look like?
What percentage of the offspring are yellow? What percentage of the offspring are heterozygous?
Nov 12­9:40 AM
Nov 12­9:36 AM
In real life, genotypes determine only part of your phenotype. What else do you think affects your traits?
Horned Monster Heredity Simulation
http://www.youtube.com/watch?v=kLpr6t4­eLI
Nov 12­9:18 AM
Nov 12­9:33 AM
23
Genetics Notes.notebook
March 05, 2015
Warm­up:
An albino person is someone with no pigmentation in his/
her skin, hair or eyes. Normal pigmentation is dominant over albino. A normal pigmented man (whose mother was albino) marries a homozygous normal woman. What are the expected phenotypes of their offspring?
Nov 12­9:33 AM
Nov 12­1:55 PM
Warm­up: Sponge Bob square pants recently met Sponge Suzy round pants. In sea sponges, square shape is dominant to round shape. Sponge Bob is heterozygous for his square shape. Create a punnett square to show the possible offspring if Bob and Suzy have children.
Determining your Genotype from your Phenotype
Nov 13­8:55 AM
Nov 13­11:09 AM
Warm­up
In pea plants, round seeds are dominant to wrinkled seeds. In a monohybrid cross of two heterozygous plants, what percent of the offspring would have round seeds?
Nov 13­9:39 AM
Nov 14­9:56 AM
24
Genetics Notes.notebook
March 05, 2015
Practice
Quiz Tomorrow!!
Learning Target: I can use the terms phenotype, genotype, allele, homozygous and heterozygous to describe a monohybrid cross.
In sheep, white coat is due to a dominant allele, and black is due to a recessive allele. A white ewe is mated to a white ram and produces a black lamb. How does this happen?
What are the genotypes of the parents?
Show the monohybrid cross in a punnett square.
Nov 14­11:18 AM
Cystic fibrosis is a genetic disorder that causes people to produce abnormally thick and sticky mucus in their lungs and airways. As a result, they are more likely to get respiratory infections that may be life threatening. On average patients live for 30 years.
Nov 13­9:26 AM
A man homozygous recessive for CF marries a woman who is heterozygous. What is the percent probability that their children will have CF?
CF is caused by a recessive allele. If you are heterozygous for this allele you will not experience any symptoms.
http://www.youtube.com/watch?v=EsCfijn­z1E
What if one parent is heterozygous and one parent is homozygous dominant (normal)?
Nov 14­10:00 AM
Nov 14­10:18 AM
The State Department of Disease Control and Prevention has required that all adolescents be tested to determine whether or not they are a carrier for CF.
Do you agree or disagree with this policy? Explain why or why not. Be prepared to share! Nov 14­10:07 AM
Assume that both you and your spouse are carriers of CF. Create a punnett square. What is the probability your child will have CF?
What choices do you now have about having children?
Nov 13­10:28 AM
25
Genetics Notes.notebook
Who should make the decision about testing newborns for genetic disorders like CF?
Parents? Community? Doctors? Nov 14­10:45 AM
Warm­up: Discuss with your table. What is one thing you know (or think you know) about genetic engineering? What is one question you have? Be prepared to share!
March 05, 2015
Warm­up: KWL Chart ­ Genetic Engineering
What I Know
What I Learned
What I Want to know
Nov 18­9:46 AM
Spend 5 minutes review your notes from this quarter.
Apr 16­8:54 AM
Oct 22­2:14 PM
Is it genetic engineering?
Warm­up: What is cancer? Why does that make it hard to treat?
Apr 16­8:57 AM
Oct 22­12:29 PM
26
Genetics Notes.notebook
March 05, 2015
What is genetic engineering?
What is it about DNA that makes it possible for us to move genes from one organism into the DNA of another organism?
Nov 18­9:56 AM
Nov 22­10:13 AM
Genetic Technology
Genetically modified organisms (GMO)
What things should scientists consider when experimenting with genetic engineering?
https://www.youtube.com/watch?v=k2NQ2SFuSN4
Cloning
https://www.youtube.com/watch?v=0WSCs78Gl9M
https://www.youtube.com/watch?v=GKm2Ch3­Myg
Therapeutic cloning
Synthetic life
Biopharmaceuticals
Apr 16­9:12 AM
Apr 16­8:56 AM
How does it work?
https://www.youtube.com/watch?v=8rXizmLjegI
Brainstorm all the topics we have covered this quarter
Nov 18­9:57 AM
Oct 22­11:12 AM
27
Genetics Notes.notebook
Warm­up: Describe one example of genetic technology that we talked about.
March 05, 2015
How to Genetically Engineer a Cell
Human cells contain a gene for making insulin
Apr 18­8:55 AM
GATTACA
http://www.youtube.com/watch?v=PFjaOnCp0lo
Discuss your table and write down your ideas on a white board. Is it ok to genetically engineer humans? Why or why not? The Island
http://www.youtube.com/watch?v=IdEsGZhAO7A
http://www.youtube.com/watch?v=pTbelq2dtKg
Discuss your table and write down your ideas on a white board. Is there ever a reason that it is ok clone humans? Why or why not?
Nov 18­10:05 AM
Genetic Engineering Presentation
May work with 1 or 2 other people. Groups of no more than 3!
We will be in computer lab 286 Monday, Tuesday and Wednesday next week to research and prepare.
You will present on THURSDAY & FRIDAY of next week.
Apr 18­7:54 AM
Nov 18­10:19 AM
Genetic Engineering Pro and Con
https://www.youtube.com/watch?v=j7fWg2gDTok
For
May 2­11:25 AM
Against
Nov 22­1:41 PM
28
Genetics Notes.notebook
March 05, 2015
Nervous System ­ National Geographic
https://www.youtube.com/watch?v=h­4fEsN­YXk
May 2­11:20 AM
29