* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetics Notes.notebook
Human genome wikipedia , lookup
Oncogenomics wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Medical genetics wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA profiling wikipedia , lookup
Genomic library wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
SNP genotyping wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA polymerase wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Designer baby wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genome editing wikipedia , lookup
Primary transcript wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Microsatellite wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
DNA supercoil wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Point mutation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Genetics Notes.notebook Warmup: Discuss with your table,what is heredity? March 05, 2015 Clasp your hands without thinking about it. Which thumb is on top? Look at your hand. Is your pinky finger bent in towards your ring finger? Do you have dimples? Do you have a cleft chin? Does your earlobe hang free or is it attached to your face at the bottom? Can you roll your tongue? Do you have a widows peak? Do you have hitchhikers thumb? Oct 410:23 AM . Oct 410:29 AM Your DNA is an macromolecule it is a nucleic acid The building blocks of DNA are nucleotides: DNA structure Nucleotides pair up using basepairing rules. The shape of a DNA molecule is called a double helix https://www.youtube.com/watch?v=09FWJbdcNlA Oct 79:36 AM DNA Molecule Pick 4 colors to represent the bases color each base accordingly http://www.youtube.com/watch?v=ubq4eu_TDFc Oct 410:49 AM Warmup: Describe how DNA is structured. Try to do it without looking at your notes! While you are coloring, I am going to come around and talk to you about science next year so I can make recommendations to the schedulers. Feb 2510:43 AM Feb 267:33 AM 1 Genetics Notes.notebook March 05, 2015 Your traits determined by your genes. So.... what are genes? http://www.youtube.com/watch?v=5MQdXjRPHmQ DNA Organization Each molecule of DNA, containing your genes, is wound tightly into a structure called a chromosome Oct 410:39 AM Feb 242:01 PM DNA modeling DNA Models 1. Describe the general structure of DNA (in your own words!) What is the official name of this shape? 2. What two molecules make the backbone of DNA? (these are the "handholds" of the ladder) 3. What bases always pair together? 4. How is your model the same as other peoples? How is it different? Feb 258:16 AM Think/Pair/Share: DNA has the same double helix structure in all living organisms. However, we know that a plant, mammal and bacteria must have different genes in their DNA to result in the very different characteristics of these different organisms. What is different in the DNA of these different organisms? Oct 710:04 AM Checkin Quiz: What 4 chemicals (just the letters) make up your DNA? What are the basepairing rules? What is the relationship between genes and DNA? Oct 109:50 AM Oct 411:54 AM 2 Genetics Notes.notebook March 05, 2015 Trade with a neighbor to correct. What 4 chemicals (just the letters) make up your DNA? What are the basepairing rules? What is the relationship between genes and DNA? Oct 37:45 AM Feb 271:43 PM 1. DNA Extraction! 2. What do you think your DNA will look like? Why? 3. Quiz on Monday! I can describe the structure of DNA and the relationship between DNA, genes and chromosomes. 4. http://www.youtube.com/watch?v=vPGKv53zSRQ 5. I can describe the process of DNA replication. 6. 7. 8. Feb 271:18 PM Have one person get the following things and bring them to your table: Oct 1510:31 AM Bioengineering http://www.youtube.com/watch?v=ovV7v2XYJAI 1. Strawberry in a plastic bag 2. Paper towel 3. Wooden stick How was this discovered? http://www.youtube.com/watch?v=d7ET4bbkTm0 4. Small beaker Oct 2111:17 AM Feb 209:22 AM 3 Genetics Notes.notebook Warmup: What is a chromosome composed of? March 05, 2015 Think/Pair/Share: If a DNA strand is 20% Adenine, what percentage is Thymine? What percentage is Cytosine? Draw and label the following picture in your notebook. http://www.youtube.com/watch?v=9kQpYdCnU14 Oct 89:22 AM Warmup: Take out a sheet of paper and a writing utensil, put everything else away. Oct 89:39 AM Warmup: We all start out as one cell. What has to happen for all of your cells to have the same DNA? Oct 37:44 AM Oct 228:34 AM We all start out as one cell. What has to happen for all of your cells to have the same DNA? DNA Replication Proteins do the work of replication. Helicase How does the DNA know which base to add to the new strand? Polymerase http://www.youtube.com/watch?v=zdDkiRw1PdU http://www.youtube.com/watch?v=zdDkiRw1PdU Oct 710:03 AM Feb 269:46 AM 4 Genetics Notes.notebook Think/Pair/Share: If this is a template strand of DNA AAT GTG CCA GGG TGT ATT What would the new strand be? March 05, 2015 Modeling Replication questions: 1. Why is this type of replication called "semi conservative"? (semi=half, conservative=save) 2. Mistakes in DNA replication lead to mutations, which may or may not be harmful. How does semiconservative replication help prevent mutations during DNA replication? Oct 89:55 AM Think/Pair/Share: Where is the "genetic code" stored in the DNA molecule? Feb 269:51 AM Warmup If this is a template strand of DNA AATGTGCCA What would the new strand be? Why must the DNA replicate? Oct 89:51 AM T/P/S: Describe the relationship between DNA, genes and chromosomes. Oct 89:52 AM DNA Replication Reading and Questions. Use the reading to answer questions 110. Sep 298:10 AM Oct 89:50 AM 5 Genetics Notes.notebook March 05, 2015 Karyotypes Warmup What is the relationship between DNA, genes and chromosomes? Chart used by geneticists to diagnose chromosomal abnormalities Oct 1111:41 AM Oct 1111:41 AM Reading a karyotype Number Down Syndrome Trisomy 21 Sex Feb 279:44 AM Turner's Syndrome XO Female no Y chromosome Oct 1112:28 PM Oct 1112:31 PM Klinefelter's Syndrome (XXY Extra X chromosome) Male Oct 1112:04 PM 6 Genetics Notes.notebook Edward's Syndrome (Trisomy 18) March 05, 2015 Make your own karyotype Oct 1112:04 PM Feb 279:53 AM + Warmup What are the two major proteins involved in DNA replication? What is the role of each protein? Warmup: What is a karyotype? Describe what it is and why you might use one. Oct 910:53 AM Oct 1411:18 AM Steps in DNA fingerprinting Warmup: What are your chromosomes made of? Where are they stored? 1. Collect a DNA sample must have cells! 2. Use a process called PCR to make the DNA replicate many times 3. Cut the samples with restriction enzymes 4. Sort pieces by length using gel electrophoresis Oct 1510:28 AM Oct 229:54 AM 7 Genetics Notes.notebook Warmup: What are the steps to DNA fingerprinting? Why does the name Polymerase Chain Reaction (PCR) make sense? March 05, 2015 Warmup How can DNA fingerprinting be used to match a suspects DNA to a DNA sample taken from a crime scene? http://www.youtube.com/watch?v=2KoLnIwoZKU Oct 222:01 PM Oct 2410:38 AM DNA fingerprinting Warmup: Where in the DNA is the genetic code stored? How is your DNA different from everyone else's DNA? Complete the DNA replication simulation (part I) Run your 'electrophoresis' test (part II) http://www.youtube.com/watch?v=ZxWXCT9wVoI Oct 229:50 AM Forensics: DNA Fingerprinting Every individual (except identical twins) has unique DNA. The differences are found in between our genes in "noncoding" DNA. Mar 48:54 AM DNA fingerprinting simulation In DNA fingerprinting, the DNA is cut into several fragments and organized according to fragment size We can use these differences to compare DNA and find out who a DNA sample came from. http://www.youtube.com/watch?v=ZxWXCT9wVoI Oct 228:35 AM Mar 49:12 AM 8 Genetics Notes.notebook DNA Fingerprinting Analysis Questions Answer the following questions in COMPLETE SENTENCES! 1. Did anyone have exactly the same pattern of bands as someone else? Why or why not? 2. Do you think someone should be convicted solely on DNA evidence? March 05, 2015 Warmup discussion each table must share out their answers! Generally, DNA libraries only store information about certain fragments of DNA not a person's full genetic code. It is exceedingly useful in identifying offenders in situations where a DNA sample is collected from a crime scene. On the other hand, the existence of such a library may violate privacy rights. 1. Should governments maintain a DNA library? Why or why not? 2. How might a DNA library be misused or abused by the police or government? Oct 2410:19 AM Review your test answers! Correct the ones you got wrong and write a one sentence explanation of your reason for picking the wrong answer and why you now know the right one. Mar 59:24 AM Oct 2410:22 AM DNA Fingerprinting Case Studies http://www.youtube.com/watch?v=LkuKBflUoJE Mar 59:24 AM Warmup: Describe the relationship between DNA, genes and chromosomes. Biochem Tests & POGIL Mar 69:18 AM Oct 612:15 PM 9 Genetics Notes.notebook March 05, 2015 Warmup Why is the order of the bases (ATCG) in DNA important? Protein Review What are the building blocks of proteins? What biological functions do proteins perform? http://www.youtube.com/watch?v=o3yQZp5Rso Oct 710:20 AM How does DNA determine our traits? Genes provide instructions for making proteins Proteins determine our traits Oct 2310:15 AM DNA Review Warmup: 1. What is the relationship between DNA, genes and chromosomes? 2. What two proteins are involved in DNA replication? What are their roles? 3. Explain the process of DNA replication in your own words. http://www.youtube.com/watch?v=o3yQZp5Rso Oct 239:46 AM Oct 1510:42 AM What do our genes code for? http://www.youtube.com/watch? v=zwibgNGe4aY&list=PLwck7c7ztQNuy8Ps7Wkc1gywm9eVgST9s Going from DNA to proteins is a two step process 1. DNA is used as a template to make RNA Transcription 2. RNA is read as instructions for a protein Translation Oct 910:54 AM Oct 239:52 AM 10 Genetics Notes.notebook March 05, 2015 Step 1 Transcription: using DNA as a template So what is RNA? to make mRNA Oct 239:55 AM Oct 239:54 AM http://www.youtube.com/watch? v=5MfSYnItYvg&list=TLXpOI46JY43MsA_a8geOtV8KOA56lig Three step process of transcription A. Practice: Transcribe this DNA into RNA B. AAT GTG CCA CGG TGG TAC C. http://www.youtube.com/watch?v=5MfSYnItYvg Oct 2310:05 AM Oct 2310:06 AM Take 10 minutes to finish your POGIL Warmup: Using complete sentences and as many vocab words as you can, compare and contrast replication and transcription. Mar 79:47 AM You must complete the questions as a group that means everyone needs to stay on task! One sheet will get turned in for everyone to get credit I will decide which member turns it in! Oct 38:17 AM 11 Genetics Notes.notebook March 05, 2015 Step 2 Translation: using mRNA as a template to make a protein Two step process of translation: A. B. ` http://www.youtube.com/watch?v=8dsTvBaUMvw http://www.youtube.com/watch?v=8dsTvBaUMvw Oct 2310:28 AM Oct 2310:38 AM How do we know which amino acids to add? Practice If I have this strand of RNA UAG GCA UUA CUG GUG How many codons? How many amino acids would be added to a protein? Oct 2310:37 AM Put it all together.... Transcribe this DNA into mRNA CTG GGT ATC GTA GCT TTC ACT AUG GGG CUU UGG Oct 2310:45 AM Transcribe this gene into mRNA. ACT TGA TTG ACG ATG GTC How do you know which mRNA base will pair with each DNA base? Translate your mRNA into a protein (amino acid chain) Mar 79:33 AM Why did I write it in 3 letter chunks? Oct 911:49 AM 12 Genetics Notes.notebook March 05, 2015 Draw this table in your note book and fill out as much as you can with your table. Replication Transcription Translation Purpose Create a poster with pictures that explains protein synthesis using only the following terms: DNA, mRNA, tRNA, proteins, transcription, translation, nucleotide Where does it occur? Whole Everyone in your group needs to be able to explain the process! molecule? Result Mar 69:34 AM Mar 58:37 AM Protein Synthesis Activity Take 15 minutes to finish up your discussions/answer questions about bear reintroduction. When you finish, get a review sheet from Ms. Canney. Mar 510:54 AM DNA: ACT TGC ATC TGT ACT TGC TTC Oct 810:33 AM Review worksheet you have the rest of the hour to work on it. If you finish have me check it, if not, it is homework! mRNA: Protein: Oct 912:21 PM Mar 711:22 AM 13 Genetics Notes.notebook Warmup: Copy these learning targets into your notebook March 05, 2015 Central Dogma of Biology I can use words and phrases to differentiate between the processes of photosynthesis and respiration in terms of energy flow, reactants and products. I can explain the relationship between DNA, genes and chromosomes. I can use a karyotype and forensic techniques to compare DNA samples. I can describe the process of DNA replication and the role of DNA and RNA in protein synthesis. Oct 2911:14 AM Oct 2310:09 AM Warmup: Summarize in a few sentences what we learned about on Friday. Try to do it without your notes. Use as many vocab words as you can! Take out your lab and look it over for any last minute questions. If you have not done so, write your hypothesis! Take out the worksheet so I can check it! Oct 2811:23 AM Mar 102:11 PM Warmup: Summarize with your table what we talked about yesterday. http://www.youtube.com/watch?v=d7ET4bbkTm0 Oct 411:13 AM Feb 242:13 PM 14 Genetics Notes.notebook March 05, 2015 Warmup 12 pt. font 2 page minimum • In your notebook write: THE CAT ATE THE RAT > Change one letter in the sentence > Did it change the meaning? Could you still understand it? Due Sunday night Feb 242:12 PM The rest of the quarter..... Nov 48:21 AM Can we read mRNA? All make up tests must be done by next Friday We will review for two days during finals week, then take a cumulative (everything we've covered this quarter) final Oct 2112:10 PM Oct 2310:43 AM Warmup: Transcribe this DNA into RNA CAC GTA GAC TGA GGA CTC Now translate the mRNA into a string of amino acids (protein) using your codon chart. .......................................................................................... Transcribe this DNA into RNA CAC GTA GAC TGA GGA CAC Translate the mRNA into a protein. Mar 119:38 AM Mar 128:43 AM 15 Genetics Notes.notebook March 05, 2015 What is a mutation? I can analyze the effect of DNA mutations (deletions, insertions, rearrangements and substitutions) on protein synthesis. Mar 119:35 AM How common are mutations? Nov 48:26 AM Types of Gene Mutations 1. Substitution 2. Insertion 3. Deletion Nov 48:24 AM Practice transcribing and translation DNA with mutations Oct 1010:31 AM Nov 48:39 AM Warmup: Insertions and deletions tend to be more harmful than substitutions, use your knowledge of mutations to explain why. Oct 101:48 PM 16 Genetics Notes.notebook Genetic Mutations March 05, 2015 Gene vs. Chromosome Learning Targets • I can analyze the effect of DNA mutations on protein synthesis. Nov 48:22 AM What are the effects of mutations? Mar 119:55 AM Genetic vs. Infectious disease Nov 48:26 AM Warmup: What is the relationship between transcription and translation? Can one exist without the other? Explain your answer. Mar 128:39 AM Sickle Cell Anemia http://www.youtube.com/watch?v=wzoWRKj7RoQ Mar 129:13 AM Mar 119:41 AM 17 Genetics Notes.notebook Warmup: Explain how a change in the DNA causes a disease like sickle cell or Tay Sachs. March 05, 2015 Think/Pair/Share Mutations are not rare. Explain why we don't see more physical changes in populations. Mar 138:47 AM Types of Mutations > 1. Gene mutations: > 2. Chromosomal mutations: Mar 128:40 AM • THE CAT ATE THE RAT > Original Gene • GHE CAT ATE THE RAT > What type of mutation is this? • THA ECA TAT ETH ERA T > Nov 48:30 AM Chromosomal Mutations What type of mutation is this? Nov 58:24 AM Silent Mutations Insertion Deletion Inversion Mar 128:34 AM Mar 139:03 AM 18 Genetics Notes.notebook Warmup Explain why an insertion mutation is more harmful than a substitution mutation. Use as much vocab as you can! March 05, 2015 How can genetic material be altered? • Natural changes: • Artificial changes: Take out Mutation worksheet for me to check. Mar 139:09 AM Mutagens Nov 58:27 AM What can mutations cause? • Chemical mutagens: Physical mutagens: Nov 58:37 AM Warmup: What is a genetic mutation? What is the result of a mutation? Nov 59:00 AM Genetic mutation is the only source of variation in a population Rock Pocket Mouse http://www.youtube.com/watch?v=wrTXvrKBlbc Oct 2010:23 AM Nov 511:57 AM 19 Genetics Notes.notebook Exit ticket: Explain why the dark fur mutation became so widespread in the population of mice. Mar 149:40 AM March 05, 2015 Warmup • How can a mutation cause a change in a trait? Nov 69:32 AM Warmup Normal gene: • Mutated gene: AGCTATATGGCTACCTATTA • AGCTATATGGCTAGGTATTA What type of mutation is this? Warmup: We have discussed several things that are caused by mutations. Describe 2 of them. • How can a mutation cause a change in a trait? Nov 59:27 AM Mar 179:47 AM Cancer is uncontrolled cell growth On a sheet of paper with your table create a KWL Chart for Cancer Oct 2112:12 PM Oct 2112:13 PM 20 Genetics Notes.notebook March 05, 2015 Exploring Mutation Exploring Cancer Activity Oct 2112:18 PM Mar 178:31 AM Genetics is the study of how traits are passed from a parent to an offspring (heredity). Title your notebook page Gregor Mendel is the "Father of Genetics" Austrian monk who studied pea plants in the mid1800s Genetics Vocabulary Many of his observations became rules that are still useful in modern genetics In my own words.... Definition http://www.youtube.com/watch?v=GTiOETaZg4w Use it in a sentence OR Picture/sketch trick to help remember it Allele heterozygous homozygous recessive dominant monohybrid cross gene genetics http://www.youtube.com/watch?v=0vAAf4g5iF8 Oct 410:46 AM Oct 79:45 AM Warmup In a sentence or two, describe what the reading we used yesterday was about. What new vocabulary words do you remember? Warmup Take 15 minutes to finish vocabulary list from yesterday. You can look at the questions if you finish early we will do them together after the 15 minutes. Allele homozygous monohybrid cross genetics Nov 711:15 AM heterozygous dominant gene recessive Nov 711:17 AM 21 Genetics Notes.notebook March 05, 2015 What is the P generation? What is the F1 generation? What is the difference between a gene and an allele? In figure 113, what is the dominant shape of the pea pod? How do you know? Brown eyes are dominant to blue eyes. A person receives the allele for brown eyes from one parent and blue eyes from the other. Allele homozygous heterozygous gene monohybrid cross dominant recessive genetics Is this person heterozygous or homozygous? Will their eyes be blue or brown? How do you know? Nov 711:19 AM Warmup: How many copies of a dominant allele must an organism have to show the dominant trait? How many recessive alleles must they have to show the recessive trait? Nov 811:25 AM Two new vocabulary words.... Smiley Face Genetics Nov 71:56 PM Sickle Cell Case Study Nov 1111:15 AM How can we predict the outcome of monohybrid crosses? Heterozygous or homozygous = Example: Punnett Squares Observable traits = Example: Nov 1111:14 AM Nov 1111:19 AM 22 Genetics Notes.notebook Warmup: Write a sentence with each of the following words be prepared to share! :) Phenotype Allele Heterozygous March 05, 2015 Practice: What are the phenotypes for the trait eye color? What are the possible genotypes for each phenotype? Brown = B Blue = b Recessive Nov 129:00 AM Yellow pea pods are dominant over green pea pods. A heterozygote is crossed with a homozygous dominant plant. Create a punnett square. Nov 129:03 AM One fruit fly is heterozygous for red eyes and the other is homozygous recessive with white eyes. 1. What is the dominant allele? 2. What are the genotypes of these two flies? 3. Create a punnett square, what would you expect their offspring to look like? What percentage of the offspring are yellow? What percentage of the offspring are heterozygous? Nov 129:40 AM Nov 129:36 AM In real life, genotypes determine only part of your phenotype. What else do you think affects your traits? Horned Monster Heredity Simulation http://www.youtube.com/watch?v=kLpr6t4eLI Nov 129:18 AM Nov 129:33 AM 23 Genetics Notes.notebook March 05, 2015 Warmup: An albino person is someone with no pigmentation in his/ her skin, hair or eyes. Normal pigmentation is dominant over albino. A normal pigmented man (whose mother was albino) marries a homozygous normal woman. What are the expected phenotypes of their offspring? Nov 129:33 AM Nov 121:55 PM Warmup: Sponge Bob square pants recently met Sponge Suzy round pants. In sea sponges, square shape is dominant to round shape. Sponge Bob is heterozygous for his square shape. Create a punnett square to show the possible offspring if Bob and Suzy have children. Determining your Genotype from your Phenotype Nov 138:55 AM Nov 1311:09 AM Warmup In pea plants, round seeds are dominant to wrinkled seeds. In a monohybrid cross of two heterozygous plants, what percent of the offspring would have round seeds? Nov 139:39 AM Nov 149:56 AM 24 Genetics Notes.notebook March 05, 2015 Practice Quiz Tomorrow!! Learning Target: I can use the terms phenotype, genotype, allele, homozygous and heterozygous to describe a monohybrid cross. In sheep, white coat is due to a dominant allele, and black is due to a recessive allele. A white ewe is mated to a white ram and produces a black lamb. How does this happen? What are the genotypes of the parents? Show the monohybrid cross in a punnett square. Nov 1411:18 AM Cystic fibrosis is a genetic disorder that causes people to produce abnormally thick and sticky mucus in their lungs and airways. As a result, they are more likely to get respiratory infections that may be life threatening. On average patients live for 30 years. Nov 139:26 AM A man homozygous recessive for CF marries a woman who is heterozygous. What is the percent probability that their children will have CF? CF is caused by a recessive allele. If you are heterozygous for this allele you will not experience any symptoms. http://www.youtube.com/watch?v=EsCfijnz1E What if one parent is heterozygous and one parent is homozygous dominant (normal)? Nov 1410:00 AM Nov 1410:18 AM The State Department of Disease Control and Prevention has required that all adolescents be tested to determine whether or not they are a carrier for CF. Do you agree or disagree with this policy? Explain why or why not. Be prepared to share! Nov 1410:07 AM Assume that both you and your spouse are carriers of CF. Create a punnett square. What is the probability your child will have CF? What choices do you now have about having children? Nov 1310:28 AM 25 Genetics Notes.notebook Who should make the decision about testing newborns for genetic disorders like CF? Parents? Community? Doctors? Nov 1410:45 AM Warmup: Discuss with your table. What is one thing you know (or think you know) about genetic engineering? What is one question you have? Be prepared to share! March 05, 2015 Warmup: KWL Chart Genetic Engineering What I Know What I Learned What I Want to know Nov 189:46 AM Spend 5 minutes review your notes from this quarter. Apr 168:54 AM Oct 222:14 PM Is it genetic engineering? Warmup: What is cancer? Why does that make it hard to treat? Apr 168:57 AM Oct 2212:29 PM 26 Genetics Notes.notebook March 05, 2015 What is genetic engineering? What is it about DNA that makes it possible for us to move genes from one organism into the DNA of another organism? Nov 189:56 AM Nov 2210:13 AM Genetic Technology Genetically modified organisms (GMO) What things should scientists consider when experimenting with genetic engineering? https://www.youtube.com/watch?v=k2NQ2SFuSN4 Cloning https://www.youtube.com/watch?v=0WSCs78Gl9M https://www.youtube.com/watch?v=GKm2Ch3Myg Therapeutic cloning Synthetic life Biopharmaceuticals Apr 169:12 AM Apr 168:56 AM How does it work? https://www.youtube.com/watch?v=8rXizmLjegI Brainstorm all the topics we have covered this quarter Nov 189:57 AM Oct 2211:12 AM 27 Genetics Notes.notebook Warmup: Describe one example of genetic technology that we talked about. March 05, 2015 How to Genetically Engineer a Cell Human cells contain a gene for making insulin Apr 188:55 AM GATTACA http://www.youtube.com/watch?v=PFjaOnCp0lo Discuss your table and write down your ideas on a white board. Is it ok to genetically engineer humans? Why or why not? The Island http://www.youtube.com/watch?v=IdEsGZhAO7A http://www.youtube.com/watch?v=pTbelq2dtKg Discuss your table and write down your ideas on a white board. Is there ever a reason that it is ok clone humans? Why or why not? Nov 1810:05 AM Genetic Engineering Presentation May work with 1 or 2 other people. Groups of no more than 3! We will be in computer lab 286 Monday, Tuesday and Wednesday next week to research and prepare. You will present on THURSDAY & FRIDAY of next week. Apr 187:54 AM Nov 1810:19 AM Genetic Engineering Pro and Con https://www.youtube.com/watch?v=j7fWg2gDTok For May 211:25 AM Against Nov 221:41 PM 28 Genetics Notes.notebook March 05, 2015 Nervous System National Geographic https://www.youtube.com/watch?v=h4fEsNYXk May 211:20 AM 29