* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Last Name - JhaveriChemBioWiki
Nutriepigenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
DNA paternity testing wikipedia , lookup
Transcription factor wikipedia , lookup
Holliday junction wikipedia , lookup
Genomic library wikipedia , lookup
Polyadenylation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA profiling wikipedia , lookup
RNA silencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Epitranscriptome wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Non-coding RNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
History of RNA biology wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Helitron (biology) wikipedia , lookup
Microevolution wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
History of genetic engineering wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Primary transcript wikipedia , lookup
Last Name: First Name: Period # March 2, 2010 Unit 3: Genetics The Central Dogma and Transcription Answer the following questions to see if you understand transcription. Central Dogma 1. Using at least one complete sentence, state the central dogma of biology. 2. Using words and arrows, show the central dogma of biology. 3. Using the central dogma, explain why RNA is important for making protein. DNA v. RNA 4. Complete this chart comparing and contrasting DNA and RNA. DNA # of strands Nitrogenous bases used Type of sugar in backbone What does it do with genetic information? Is it made of nucleotides? Where is it found? Complimentary strand to DNA of GATTACTACGA? Complimentary strand to DNA of TTTAGGGCCCAT RNA Transcription 5. What is the definition of transcription? 6. What part of DNA and RNA is the genetic information? What does the genetic information give instructions for making? 7. Transcribe these DNA strands into their complimentary mRNA strands. A. : GGGCCCGATAGGGAAAATTAGATCCT B. ATATGGGAAACCTAGCTACTATCAAAGGTTA Test Prep Sections: These questions were taken from New York and Texas State Tests. Can you compete with the brightest around the nation? 90 The molecule coded directly from DNA is represented by number (1) 1 (3) 3 (2)2 (4)4 22 Erwin Chargaff studied the DNA of organisms within a single species. Chargaff discovered that the amount of adenine is about equal to the amount of thymine. Which of these explains why the ratio of adenine to thymine is nearly 1:1? A Adenine and thymine pair with each other. B Adenine binds with phosphates, while thymine binds with nitrates. C Adenine and thymine are identical in chemical composition. D Adenine bases contain a form of thymine.