Download CH 14 Gene Expression: From Gene to Protein and

CH 14 Gene Expression: From Gene to Protein and Regulation (Parts of CH 15)
Overview: Flow of Genetic Information – “Central Dogma!” Bk Pg 271 Gives Overview!

Diagram:

NOTE: The Focus now is on _________  ____________ b/c out of
__________ base pairs in the human genome, only ____________ gene’s
have been ID’ed  only 1.5% of DNA actually undergoes both _____________
and ________________ to form ______________!!!!!!!

? What does the other 98.5% do? It used to be called ____________!!!! Now
we know that it forms many types of _____________ that have specific
functions – these functions are what scientists are trying to ID.
New Facts from HGP and other “OME’s”:

OUR FOCUS: On the RNA’s that are involved in __________________ to
form Polypeptides (Proteins). There are THREE MAIN RNA’s INVOLVED:
1. ______________________ : Carries a nucleotide code from DNA (in the
nucleus of _________________ cells) to the __________________ in order to
direct the synthesis of a _____________________ chain (it could be a
complete protein at this point, but some join others to form a _____ level
protein). NOTE: The code directs the order of ____________ in the chain.
2. _______________________ : Reads the mRNA 3 base ___________ and
brings the correct ________________ in the specified order to build the
_________________ chain. NOTE: ______________ / clover shape that folds
up due to RNA base compliments( ______________-stranded RNA), a 3 base
_______________ that is a compliment to the mRNA ___________, and
carries a specific _____________
Diag: Book Page 279 Fig 14.15 /Comic Pg136 - Plus build w/ Pipe-Cleaner
3. ________________________ : coils up around proteins to from the TWO
subunits of the _____________________ (found free floating in ___________
or attached to the __________). NOTE: This is the site of _______________.
Diag: Book Page 281 Fig 14.17

All THREE of the RNA’s involved in Translation MUST be AVAILABLE or it
will not be able to occur. EXAMPLE: Just like Building a House!!!
House Analogy:
_______________________ (DNA) is in charge of constructing the
_________________ (mRNA) which is read by the ________________ (tRNA)
who will bring all of the MATERIALS ( _________________) to the WORKSITE
(__________) where the COMPLETE HOUSE ( __________________________)
will be formed. All of this reguires $ (_______). The POINT is that if you take
AWAY ANY of these KEY PLAYERS, you will NOT be able to COMPLETE the
CONSTRUCTION!!!!!
? How was the Fundamental Relationship between genes and proteins
Discovered???
In 1902, British physician Archibald ___________________ first suggested that
genes dictate phenotypes through enzymes that catalyze specific chemical
reactions. His FOCUS was on the INHERITANCE of a Metabolic Disorder called
____________________________!!!! He traced the Inheritance through families
using _____________________. See Old Notes!!!
In the 1930’s, ______________________ & ______________________ did
experimental work to prove their Hypothesis that “ ONE _____________ EQUALS
ONE _____________________”!
HOW???

View Slide Animation from DNA From The Beginning CD #16

MO = ________________________________________

Why Key to the Experiment?

Experimental Procedure / Results:
= Use _______________ / radiation to cause a ________________ in a
________ of the Neurospora - able to observe the impact of this by
observing the ability of it to grow on ____________________ medium.
= NOTE:
If it CAN GROW, it must be able to produce ALL necessary
________________ to synthesize (metabolize) ALL needed amino acids
and vitamins from the minimal medium. (Do Diagram)
If it CAN NOT GROW, then the X-Rays caused a mutation in a
______________ responsible for ONE _________________ that NOW is
Not Functional to metabolize One of the needed _______________ OR
___________________ from the minimal medium why you see NO
GROWTH!!!! (Do Diagram)
= Diagram of GROWTH on MINIMAL MEDIUM:
= Diagram of NO GROWTH on MINIMAL MEDIUM:
NOTE: In order to Find WHICH GENE was mutated, they
First had to GROW UP the Mutated Stock on COMPLETE
MEDIUM. They then transferred samples of the Suspeceted
MUTANT to Minimal Medium to VALIDATE a mutation by
observing ___________________!! They then went back to
the MUTANT STOCK on Complete and transferred some to
Minimal Medium that Had Either ALL Essential _____ OR
ALL Essential ______. If Growth, now know WHICH catefory
it is Missing and can now TEST by Moving to Minimal
Medium w/ 1SUPPLEMENT added at a time (only 1 variable!).
When Growth DID OCCUR, it positively ID’ed the Link to the
original MUTATED GENE!!!!
NOTE: Your book diagram reveals the Arginine Mutant – It is more complicated
than the Vit B-6 diagramed abouve due to it having different genes involved
leading to different Agrinine Mutants. Beadle and Tatum ended up with a
collection of Neurospora mutants and catalogued them based on their defect. One
Set of Mutants ALL Required argainine for growth. It was revealed that each
mutant was blocked at a different step in the biochemical pathway for arginine
biosynthesis. Yet, Each Gene was still connected to the production of 1 Enzyme
which SUPPORTS their Hypothesis!!! Don’t worry about the details of this
example!
Beadle and Tatum’s ONE GENE = ONE ENZYME has been Revised and/or
Disproven in Certain Scenario’s!!!
1st – 1 Gene = 1 Protein b/c
2nd – 1 Gene = 1 Polypeptide b/c
3rd – 1 Gene = ???? Many Different Polypeptides due to _____________________
4th – 1 Gene DOES NOT = ANY of the Above if _________________ GENE!!!
(See Book Page 270)
The GENETIC CODE!
1961 = __________________ (of the duo who built the first DNA model) devised an
experiment to determine the NUMBER of _________________ in a
_______________ (in the mRNA to call for the proper a.a.)

Note: The actual experiment is extremely complicated and requires the
ability to read a 6 Frame Reading Frame printout to start! It is better left to
be tackled in an upper level college course!!!!! FYI: the MO he used was a
BACTERIOPHAGE!!!!!

The THOUGHT Behind his Hypothesis:
1st : The 1st Problem: How many bases are in a mRNA Codon?

There are 4 Bases that can be used in a mRNA Codon:
_____



_____
_____
_____
If 1 Base Codon ____ or ____ possible codons – Not Enough for the
________ amino acids
If 2 Base Codon ____ or _____ possible codons – Not Enough for the
_______ amino acids
If 3 Base Codon ____ or _____ possible codons – Enough for the
_______ amino acids and then some!!!!!! That means that the code is
__________________ / some a.a.’s have _________ codon PLUS there
are codon’s that call for a _________________ (not an a.a.) – This
Became HIS ACCEPTED HYPOTHESIS!!!!!!!
2nd Problem: How are the CODON’s written in the DNA????


They can be __________________ (Gaps In Between) or
________________________ (Directly Next To Eachother) BK Pg 273
Reading Frame Paragraph!
THIS IS WHERE IT GETS CONFUSING!!!! TRUST that Mr. Crick knew
what he was doing and ACCEPT that the Triplet Code lies directly next
to each other The _______________________ Hypothesis was
Accepted!!!!!
Breaking the Genetic Code:

In 1961, __________________________ created synthetic mRNA’s and
analyzed the Polypeptide Product that it produced after translation in a cell
free environment (Test tube with all _________________, the key enzymes,
ribosomes, tRNA’s and NO OTHER _______________)

See Comic Book Pages 134 & 135

Ex. Synthetic Poly-C mRNA:
 RESULT: _______ Codon Combinations that Code for ___________ AND
______ that code for ______________________
The UNIVERSAL Genetic Code:

Strong support that all living organisms share a common ________________
heritage

All Organisms use the same 3-base _______________ to call for / ID the
same ________or_______________ (Exceptions Do Exist – Extra Info Below)

Ex: ACU = calls for _____________________ in ANY living organism  why
geneticists can take a _____________ from one organism and put it into
another organism (this organism undergoes _________________________ ).
The process of __________________ and then
_____________________________ will occur within this cell to make the
________________________ product. It will also carry out _______________
to pass the new gene on to new cells!!!

EX. ______________________ of E. coli with pGLO plasmid (We will do this
experiment)

EX: Human _________________ Gene = Put into ______________ to produce
the ___________________ protein!!!! (Major Landmark in Genetic
Engineering!)
Quick Diagram of Experiment:

EXCEPTIONS to the UNIVERSAL CODE!!!
Ex’s of where different codes have been found: Additional Source
Since these are all ____________________ organisms or
___________________, it is believed that the Evolutionary
Change came after the _______________________ of
bacteria to create the ___________________ and the
_____________________.
What are the most COMMON Exceptions?
1-
2-
NOTE: Since Mitochondria have their own DNA (and you get your
mitochondria from your ______________________), DNA Fingerprints can be
done on mitochondrial DNA during crime investigations – link to your
maternal relatives. This is important if you get a piece of _______________
that lacks a follicle – there is no _________________ DNA, but there is
mitochondrial DNA in it!!!!
Extra Info / FYI: Reading the DNA code to locate genes can become even
more complicated than you think. For Example, the DNA code for my
Bacteriophage Virus (Pipefish) had to be read to ID the genes. Not only do
viruses use 3 different start codons (Not just _________________), but all
organisms have 6 possible READING FRAMES (See 6 Frame Diagram of this
– Attched at END of Packet). This is also why it is WAY TOO COMPLICATED
to really explain Crick’s Experiment.
TO SIMPLIFY THINGS, WE WILL FOCUS ONLY ON EXAMPLES THAT USE
THE “UNIVERSAL CODE” IN OUR CLASS!!!!
SECTION 14.2: “TRANSCRIPTION”

NOT as Complex as Replication!!!! WHY???? _________________________

View Video Clip of Txn (BioLiv2ndEd – if it works??)
Diag = 3 parts of a Gene:

DNA  RNA (Many types can be made – Must be ______ if it will go on to be translated)
?

?Needs a SINGLE Enzyme to carry it out? What one? ___________________
NOTE: It can be part of a LARGER COMPLEX
called a transcription complex!! More to
Come!!

Function of _____________________ = TXN Bubble!
1. RNA Polymerase Recognizes a ____________ Site Seq
on the _______________ Strand of DNA Helix just upstream
from the Coding Region of the Gene! More to Come!
2. RNA Polymerase Initiates _____________ of the Parent
Helix as it progresses down Coding Region. No need
for _______________, it does it all on its own!
3. Only 1 PARENT DNA Strand is Used:
“_______________________” Why?
4. Newly made RNA Transcript separates from
template as the RNA Polymerase/TXN Bubble
moves ahead! The DNA ________________ and
_________________ strands Rewind! Note Names!
Why?
5. TXN Ends when the RNA Polymerase transcribes a Sequence that
causes the _______________________ Region of the Gene to Signal for
the Release of the newly made RNA Transcript and the Departure of the
RNA Polymerase from the DNA Helix!

TXN in Prokaryotes vs. Eukaryotes:
PROKARYOTES:
Cell w/ __________________ (Bact)
TXN & Other Processes occur in
____________________
EUKARYOTES:
Cell w/ ___________________
TXN in _______________ & then
RNA product(s) move to
______________ (this move will
require special modifications with 
in environment)
________ type of RNA Polymerase.
________ type of RNA Polymerase.
Note: One Promoter can be
Different RNA Polymerases for
associated with a Coding Region that transcribing different types of RNA.
codes for a # number of related
See Comic Book Pg 143
proteins.
Operons - Lac Operon – Pg 296
EX:
RNA Polymerase I =
RNA Polymerase II =
RNA Polymerase III =

? How Does RNA Polymerase Know WHERE to START ?
Answer: Must ID the _______________ Region
(Similar to how DNA Polymerase III had to ID and build off of a ______________________ But RNA Polymerase’s can start from Scratch!!)

? How is the ____________________ Region IDENTIFIED?
Answer: RNA Polymerase is part of a _________________ Complex – Refer
to Diagram of this complex / also on pgs 300-302 / PLUS WIKI Clips)

STEPS of TRANSCRIPTION: (see bk pgs 274-246 – Fig 14.8 and 14.9 only
give basics of step 1)
Step 1: _________________________: Binding of RNA Polymerase to the
DNA _________________ strand based on the recognition of a
________________ sequence.
= EXAMPLE: __________ Box! Recognized by __________ binding protein
AND _______________ / ______________ interaction (repressors off) See
Diag. of TXN Complex (attached at END of Packet)
= KEY to Step One is the _______________________________________!!!
Note: Prokaryotes do NOT use TF’s, RNA Polymerase is placed on it’s own
using a TATA Sequence Recognition.
Extra Info about Cell Type Specific Transcription Inititation from Pg 302!
What if ANOTHER Gene in the SAME CELL uses the SAME THREE
Activators?
This would be the Eukaryotic Equivalent to Prokaryotic __________________
Step 2: _______________________: RNA Polymerase moves along DNA
Template strand (NOTE: Template runs ______________ RNA made
____________) and the DNA helix continues to _________________ as the
TXN ___________ moves forward and __________________ after it passes!
Refer to the TXN BUBBLE Image Previously in the notes!
Step 3: ________________________: Stop Sequence in ________ Template
signals for the Release of the RNA Transcript. Prokaryotes and Eukaryotes
differ and many unique mechanisms for each.
Euk Ex. Polyadenylation signal in Coding Region signals for Enzymes to
asseble in Termination Region and Cleave the Transcript from the
Polymerase and Template! Still not FULLY Understood to give details!
Prok Ex. GC Hairpin –
Regardless of Mechanism, the ___________________________ is free and
can be Used Again!!!!!!
Step 4: __________________________________ of mRNA TRANSCRIPTS:
ONLY in EUKARYOTES! See Section 14.3 Pages 276-278
= WHY?
FOUR DIFFERENT AREAS of FOCUS:
1st - ALL mRNA Transcripts – Must Occur: (Refer to Comic Book page 146)
1)
2)
2nd – MOST Eukaryotic mRNA Transcripts also undergo:
________________________: (More Detail Pg 300 and Pg 304 in CH15)
= A _________________________ assembles and Modifies the _______
mRNA transcript by Excising OUT _______________ and Leaving IN
__________________ to make a _______________ mRNA transcript
= Memory AID:
_______________ INTerfere and _____________ are EXpressed!!!!!!!
HOW?
DNA Regions:
(1) _____________
contain the nucleotide base sequence that
holds the codons for building the desired protein EXPRESSED / “Coding
Region”
(2) _____________
regions of DNA that are still transcribed into
mRNA, but are NOT involved in making the protein must be spliced out!!!
They INTERFERE and are the “Non-Coding Region”
? How are INTRONS ID’ed???
Answer: By a ___ ___ start sequence and an ___ ___ end sequence
that is recognized by a __________________ complex that will cut it
out!!!!
Diagram of “SPLICING”:
1O mRNA–Exact transcript from DNA! 1O b/c NOT complete yet!!! (AkA-Precursor)
GTP
Cap
POLYA Tail
Splicing Occurs:
Results in MATURE mRNA:
GTP
Cap
POLY –
A Tail

MATURE mRNA is now ready to leave the NUCLEUS & attach to a
RIBOSOME in the Cytoplasm for translation

NOTE: “_____________________ Splicing” can occur to produce different
Mature mRNA transcripts from the SAME 1O mRNA transcript. For
EXAMPLE:
GTP
Cap
POLYA Tail
GTP
Cap
NOTE: ALTERNATIVE SPLICING Can
Occur – This is what Allows 1 CODING
Gene to be Transcribed into 1 PremRNA, but then give Rise to
ALTERNATE VERSIONS of the Mature
mRNA Transcript – Each leading to a
DIFFERENT ___________________!!!!!
This is why the Human Genome can
ONLY have _______________ Coding
Genes but over ________________
Proteins! Beadle and Tatum’s 1 Gene
= 1 Polypeptide would be MOST
ACCURATELY Stated as
“1 Coding Gene = 1 ____ mRNA!”
* Comic Book Pages 147-149
POLY –
A Tail
GO to the CH14 Gene Expression / Regulation CH15 Wiki and VIEW the
Spliceosome Step by Step Animation and READ ABOUT:
EXON SKIPPING DRUGS???? DMD – Duchene’s Muscular Dystrophy!!!!
3rd – mRNA Editing
A Enzyme/Protein Complex called _______________ Modifies the 1 0 mRNA
transcript by replacing some of the “A” N-Bases with “I” ______________.
Chemically, “I” acts as “G” so it changes how a codon is read:
AAU becomes AIU which is now Read as AGU Result??? Asn to Ser
This Changes the _________________________________!!! Just like the
Alternate Mature mRNA’s after Alternative Splicing!
Statistic at One Point in Time: 1637 Genes undergo editing w/ 12,732 A to I
edits! This is constantly changing, so GOOGLE it for More Info if Interested!
They are LINKING many Disorders to Faulty ADAR Activity!!!
Abstract from PubMed to support!
4th – RNAi Page 305 and 306!
Regulation of a MATURE mRNA Transcript my miRNA (or siRNA)
miRNA:
siRNA:
Simplified Diagram: Plus – See Animations on Wiki!
Oncogene – Coding Gene that Leads to CANCER (Codes for Proteins that
Speed up Cell Cycle – BK Pg 324 CH16)
Tumor Supressor – Coding Gene that Supresses/Stops Uncontrolled Cell
Growth/Cancer (Codes for Proteins that either Proofread to Repair
Mutations in proto-oncogenes OR Code for Proteins that STOP Cell Cycle at
Proper CheckPoints / like Brakes of a car – BK Pg 325 CH16)
oncoMIR???? _________________ Gene that codes for a _______________
that can act on the transcript from a ______________________ Gene to STOP
it from Functioning and LEAD TO CANCER!!!
Note: How a _____________________ gene can now be another Cause of
Cancer!!
SECTION 14.4: “TRANSLATION”

View Video Clip of Translation (BioLiv2ndEd if it still works!)

_________  ________________
?

? NEEDED ?
= ______ = Binds w/ Proteins to from the Ribosomes (2
subunits) – Bk pg281 Fig 14.17
= ______ = Hairpin Shape!!!
Diag Below
= Note: __________________________________
binds the proper a.a. to the correct tRNA. (Bk Pg
280 Fig 14.16) – also called Activating Enzymes
for General Name!!!
= Start / Stop “Codons” or Signals:
____
____ ____ ____ * Stop Codons call for a _________________, NOT
an a.a.  Count as a CODON # in the gene, but
not as an a.a. in the chain.
= WOBBLE – See Page 280 – Why there are not 61
tRNA’s!
 4 STEPS of the Translation Process:
STEP 1: ______________________ : Formation of the Initiation Complex.
(Bk Pg 282 / Fig 14.18)
Diagram of Step 1:
NOTE: Initiating Factors/Enzymes assemble the complex – Not Shown in the
Diagram!
NOTE: The 1st tRNA binds at the “P” site, all others will bind at the “A” site.
NOTE: If the “A” site has CCU, What is the next tRNA Anticodon? _________
What will be the next aa? _______
STEP 2: ______________________ : 2nd tRNA reads the codon in the “A” site
to bring the next a.a. in the chain
: the a.a. in the “P” site and “A” site join
by a ____________________________
reaction. Diag:
Diagram of Step 2: ___________________ and Step 3: ___________________
Note: This repeats for every New Codon that comes into the “A” site until a
STOP Codon is reached!!! Bk Pg 282 and 283
STEP 3: ____________________________! The RIBOSOME will move down
____Nucleotides on the mRNA (1 Codon!) in the __________ direction after
EACH elongation.
= The EMPTY tRNA is shifted from the “P” site to the “E” site where it is
E-jected AND another ____________________________/Activating Enzyme
will bind a New a.a. to it for Re-Use! The “A” site is now open for the NEXT
Elongation!!
STEP 4: _______________________: Codon calls for a Nonsense Codon /
STOP!!! A Release Factor comes to
the “A” site and signals the release of
the Polypeptide Chain along with the
Dis-Assembly of the whole Initiation
Complex. (Bk Pg 282 and 282 / Fig
14.20)
Diagram of Step 4:
Step 5: POST Translational Modifications!
Go to WIKI to Read Article on POST Translation with Inteins and Exteins!
Glycosylation is also a Post-Tranlational Modification that occurs in the
GOLGI! NOTE: Before it goes to the GOLGI, it must have come from the
______!!! That means that it was made on a RIBOSOME that HAS to
________________ to the ER!!! HOW? BK Pg 285 Rig 14.21
All Translation starts on a _____________ Ribosome in the ___________and
then the newly made polypeptide has a SIGNAL PEPTIDE sequence about
20aa’s long at the ___-Terminus that is recognized by a complex called the
__________ (Signal-Recognition Particle). This escorts the ribosome to a
receptor on the ER.
PROKARYOTIC vs EUKARYOTIC Comparison:
What are the Differences and Why????
Page 286:
Both Prokaryotes and Eukaryotes:
Only Prokaryotes:
14.5: Mutations – Changes in the genetic material
Point Mutation – Chemical Changes in just ONE or a FEW Nucleotide Pairs
affecting the DNA Template Sequence of the Gene. This CAN Lead to the
Production of an Abnormal Protein.
Most Recgonized Example:
Beta Globin Gene of Hemoglobin!
TWO Categories:
1) Nucleotide Pair Substitution – Seen with Hemoglobin (Missense)
2) One or more Nucleotide Pair Insertions or Deletions!
See Diagram: Add Definitions on Diag:
Eukaryotic Gene Expression is REGULATED at MANY STAGES!!!
THIS is an AREA of MAJOR Focus!!!!!!! The DNA Level with Chromatin
Modification has opened up the new area of “EPIGENETICS”! Not Picture at
the TRANSLATION LEVEL would be the use of miRNA to STOP the
TRANSLATION of a polypeptide/protein product!!!
WE FINALLY FINISHED!!!!

Be sure to FOCUS on ALL of the DIAGRAMS in these CHAPTERS!!!
PRACTICE PROBLEM #1: Use Page 273 in Book for Chart!!
DNA  ______  ____________
3’
T
A
C
T
T
A
A
C
C
A
C
T
C
G
C
5’
PRACTICE PROBLEM #2 = Given the a.a., Fill in the Rest
3’ ____ ____ ____ 5’
DNA
5’ ____ ____ ____ 3’
5’ ____ ____ ____ 3’ mRNA Codon
____ ____ ____
tRNA AntiCodon
TRYPTOPHAN (aa in protein)
PRACTICE PROBLEM #3 = Practice Splicing
1O mRNA AUGCCGGUAACGGAGCCUAAGUAGCCC
STUDY for CH 14/15 Exam (All Note-Sheets, Comic Book, and Book/Figures)
PLUS a few ?’s will come from Chapter 13 (Rep Fork Diag & ScientistsContribution to DNA discovery/structure)
Comic Book
6 Frame
Old Book PG 326 and 327 with Splceosome ID Info