* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download CH 14 Gene Expression: From Gene to Protein and
Cancer epigenetics wikipedia , lookup
Human genome wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
DNA vaccination wikipedia , lookup
Gene therapy wikipedia , lookup
Genome (book) wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA polymerase wikipedia , lookup
Molecular cloning wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genome evolution wikipedia , lookup
Epigenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
RNA interference wikipedia , lookup
Expanded genetic code wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Transfer RNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Epigenetics of human development wikipedia , lookup
RNA silencing wikipedia , lookup
Designer baby wikipedia , lookup
History of genetic engineering wikipedia , lookup
Polyadenylation wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of RNA biology wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
CH 14 Gene Expression: From Gene to Protein and Regulation (Parts of CH 15) Overview: Flow of Genetic Information – “Central Dogma!” Bk Pg 271 Gives Overview! Diagram: NOTE: The Focus now is on _________ ____________ b/c out of __________ base pairs in the human genome, only ____________ gene’s have been ID’ed only 1.5% of DNA actually undergoes both _____________ and ________________ to form ______________!!!!!!! ? What does the other 98.5% do? It used to be called ____________!!!! Now we know that it forms many types of _____________ that have specific functions – these functions are what scientists are trying to ID. New Facts from HGP and other “OME’s”: OUR FOCUS: On the RNA’s that are involved in __________________ to form Polypeptides (Proteins). There are THREE MAIN RNA’s INVOLVED: 1. ______________________ : Carries a nucleotide code from DNA (in the nucleus of _________________ cells) to the __________________ in order to direct the synthesis of a _____________________ chain (it could be a complete protein at this point, but some join others to form a _____ level protein). NOTE: The code directs the order of ____________ in the chain. 2. _______________________ : Reads the mRNA 3 base ___________ and brings the correct ________________ in the specified order to build the _________________ chain. NOTE: ______________ / clover shape that folds up due to RNA base compliments( ______________-stranded RNA), a 3 base _______________ that is a compliment to the mRNA ___________, and carries a specific _____________ Diag: Book Page 279 Fig 14.15 /Comic Pg136 - Plus build w/ Pipe-Cleaner 3. ________________________ : coils up around proteins to from the TWO subunits of the _____________________ (found free floating in ___________ or attached to the __________). NOTE: This is the site of _______________. Diag: Book Page 281 Fig 14.17 All THREE of the RNA’s involved in Translation MUST be AVAILABLE or it will not be able to occur. EXAMPLE: Just like Building a House!!! House Analogy: _______________________ (DNA) is in charge of constructing the _________________ (mRNA) which is read by the ________________ (tRNA) who will bring all of the MATERIALS ( _________________) to the WORKSITE (__________) where the COMPLETE HOUSE ( __________________________) will be formed. All of this reguires $ (_______). The POINT is that if you take AWAY ANY of these KEY PLAYERS, you will NOT be able to COMPLETE the CONSTRUCTION!!!!! ? How was the Fundamental Relationship between genes and proteins Discovered??? In 1902, British physician Archibald ___________________ first suggested that genes dictate phenotypes through enzymes that catalyze specific chemical reactions. His FOCUS was on the INHERITANCE of a Metabolic Disorder called ____________________________!!!! He traced the Inheritance through families using _____________________. See Old Notes!!! In the 1930’s, ______________________ & ______________________ did experimental work to prove their Hypothesis that “ ONE _____________ EQUALS ONE _____________________”! HOW??? View Slide Animation from DNA From The Beginning CD #16 MO = ________________________________________ Why Key to the Experiment? Experimental Procedure / Results: = Use _______________ / radiation to cause a ________________ in a ________ of the Neurospora - able to observe the impact of this by observing the ability of it to grow on ____________________ medium. = NOTE: If it CAN GROW, it must be able to produce ALL necessary ________________ to synthesize (metabolize) ALL needed amino acids and vitamins from the minimal medium. (Do Diagram) If it CAN NOT GROW, then the X-Rays caused a mutation in a ______________ responsible for ONE _________________ that NOW is Not Functional to metabolize One of the needed _______________ OR ___________________ from the minimal medium why you see NO GROWTH!!!! (Do Diagram) = Diagram of GROWTH on MINIMAL MEDIUM: = Diagram of NO GROWTH on MINIMAL MEDIUM: NOTE: In order to Find WHICH GENE was mutated, they First had to GROW UP the Mutated Stock on COMPLETE MEDIUM. They then transferred samples of the Suspeceted MUTANT to Minimal Medium to VALIDATE a mutation by observing ___________________!! They then went back to the MUTANT STOCK on Complete and transferred some to Minimal Medium that Had Either ALL Essential _____ OR ALL Essential ______. If Growth, now know WHICH catefory it is Missing and can now TEST by Moving to Minimal Medium w/ 1SUPPLEMENT added at a time (only 1 variable!). When Growth DID OCCUR, it positively ID’ed the Link to the original MUTATED GENE!!!! NOTE: Your book diagram reveals the Arginine Mutant – It is more complicated than the Vit B-6 diagramed abouve due to it having different genes involved leading to different Agrinine Mutants. Beadle and Tatum ended up with a collection of Neurospora mutants and catalogued them based on their defect. One Set of Mutants ALL Required argainine for growth. It was revealed that each mutant was blocked at a different step in the biochemical pathway for arginine biosynthesis. Yet, Each Gene was still connected to the production of 1 Enzyme which SUPPORTS their Hypothesis!!! Don’t worry about the details of this example! Beadle and Tatum’s ONE GENE = ONE ENZYME has been Revised and/or Disproven in Certain Scenario’s!!! 1st – 1 Gene = 1 Protein b/c 2nd – 1 Gene = 1 Polypeptide b/c 3rd – 1 Gene = ???? Many Different Polypeptides due to _____________________ 4th – 1 Gene DOES NOT = ANY of the Above if _________________ GENE!!! (See Book Page 270) The GENETIC CODE! 1961 = __________________ (of the duo who built the first DNA model) devised an experiment to determine the NUMBER of _________________ in a _______________ (in the mRNA to call for the proper a.a.) Note: The actual experiment is extremely complicated and requires the ability to read a 6 Frame Reading Frame printout to start! It is better left to be tackled in an upper level college course!!!!! FYI: the MO he used was a BACTERIOPHAGE!!!!! The THOUGHT Behind his Hypothesis: 1st : The 1st Problem: How many bases are in a mRNA Codon? There are 4 Bases that can be used in a mRNA Codon: _____ _____ _____ _____ If 1 Base Codon ____ or ____ possible codons – Not Enough for the ________ amino acids If 2 Base Codon ____ or _____ possible codons – Not Enough for the _______ amino acids If 3 Base Codon ____ or _____ possible codons – Enough for the _______ amino acids and then some!!!!!! That means that the code is __________________ / some a.a.’s have _________ codon PLUS there are codon’s that call for a _________________ (not an a.a.) – This Became HIS ACCEPTED HYPOTHESIS!!!!!!! 2nd Problem: How are the CODON’s written in the DNA???? They can be __________________ (Gaps In Between) or ________________________ (Directly Next To Eachother) BK Pg 273 Reading Frame Paragraph! THIS IS WHERE IT GETS CONFUSING!!!! TRUST that Mr. Crick knew what he was doing and ACCEPT that the Triplet Code lies directly next to each other The _______________________ Hypothesis was Accepted!!!!! Breaking the Genetic Code: In 1961, __________________________ created synthetic mRNA’s and analyzed the Polypeptide Product that it produced after translation in a cell free environment (Test tube with all _________________, the key enzymes, ribosomes, tRNA’s and NO OTHER _______________) See Comic Book Pages 134 & 135 Ex. Synthetic Poly-C mRNA: RESULT: _______ Codon Combinations that Code for ___________ AND ______ that code for ______________________ The UNIVERSAL Genetic Code: Strong support that all living organisms share a common ________________ heritage All Organisms use the same 3-base _______________ to call for / ID the same ________or_______________ (Exceptions Do Exist – Extra Info Below) Ex: ACU = calls for _____________________ in ANY living organism why geneticists can take a _____________ from one organism and put it into another organism (this organism undergoes _________________________ ). The process of __________________ and then _____________________________ will occur within this cell to make the ________________________ product. It will also carry out _______________ to pass the new gene on to new cells!!! EX. ______________________ of E. coli with pGLO plasmid (We will do this experiment) EX: Human _________________ Gene = Put into ______________ to produce the ___________________ protein!!!! (Major Landmark in Genetic Engineering!) Quick Diagram of Experiment: EXCEPTIONS to the UNIVERSAL CODE!!! Ex’s of where different codes have been found: Additional Source Since these are all ____________________ organisms or ___________________, it is believed that the Evolutionary Change came after the _______________________ of bacteria to create the ___________________ and the _____________________. What are the most COMMON Exceptions? 1- 2- NOTE: Since Mitochondria have their own DNA (and you get your mitochondria from your ______________________), DNA Fingerprints can be done on mitochondrial DNA during crime investigations – link to your maternal relatives. This is important if you get a piece of _______________ that lacks a follicle – there is no _________________ DNA, but there is mitochondrial DNA in it!!!! Extra Info / FYI: Reading the DNA code to locate genes can become even more complicated than you think. For Example, the DNA code for my Bacteriophage Virus (Pipefish) had to be read to ID the genes. Not only do viruses use 3 different start codons (Not just _________________), but all organisms have 6 possible READING FRAMES (See 6 Frame Diagram of this – Attched at END of Packet). This is also why it is WAY TOO COMPLICATED to really explain Crick’s Experiment. TO SIMPLIFY THINGS, WE WILL FOCUS ONLY ON EXAMPLES THAT USE THE “UNIVERSAL CODE” IN OUR CLASS!!!! SECTION 14.2: “TRANSCRIPTION” NOT as Complex as Replication!!!! WHY???? _________________________ View Video Clip of Txn (BioLiv2ndEd – if it works??) Diag = 3 parts of a Gene: DNA RNA (Many types can be made – Must be ______ if it will go on to be translated) ? ?Needs a SINGLE Enzyme to carry it out? What one? ___________________ NOTE: It can be part of a LARGER COMPLEX called a transcription complex!! More to Come!! Function of _____________________ = TXN Bubble! 1. RNA Polymerase Recognizes a ____________ Site Seq on the _______________ Strand of DNA Helix just upstream from the Coding Region of the Gene! More to Come! 2. RNA Polymerase Initiates _____________ of the Parent Helix as it progresses down Coding Region. No need for _______________, it does it all on its own! 3. Only 1 PARENT DNA Strand is Used: “_______________________” Why? 4. Newly made RNA Transcript separates from template as the RNA Polymerase/TXN Bubble moves ahead! The DNA ________________ and _________________ strands Rewind! Note Names! Why? 5. TXN Ends when the RNA Polymerase transcribes a Sequence that causes the _______________________ Region of the Gene to Signal for the Release of the newly made RNA Transcript and the Departure of the RNA Polymerase from the DNA Helix! TXN in Prokaryotes vs. Eukaryotes: PROKARYOTES: Cell w/ __________________ (Bact) TXN & Other Processes occur in ____________________ EUKARYOTES: Cell w/ ___________________ TXN in _______________ & then RNA product(s) move to ______________ (this move will require special modifications with in environment) ________ type of RNA Polymerase. ________ type of RNA Polymerase. Note: One Promoter can be Different RNA Polymerases for associated with a Coding Region that transcribing different types of RNA. codes for a # number of related See Comic Book Pg 143 proteins. Operons - Lac Operon – Pg 296 EX: RNA Polymerase I = RNA Polymerase II = RNA Polymerase III = ? How Does RNA Polymerase Know WHERE to START ? Answer: Must ID the _______________ Region (Similar to how DNA Polymerase III had to ID and build off of a ______________________ But RNA Polymerase’s can start from Scratch!!) ? How is the ____________________ Region IDENTIFIED? Answer: RNA Polymerase is part of a _________________ Complex – Refer to Diagram of this complex / also on pgs 300-302 / PLUS WIKI Clips) STEPS of TRANSCRIPTION: (see bk pgs 274-246 – Fig 14.8 and 14.9 only give basics of step 1) Step 1: _________________________: Binding of RNA Polymerase to the DNA _________________ strand based on the recognition of a ________________ sequence. = EXAMPLE: __________ Box! Recognized by __________ binding protein AND _______________ / ______________ interaction (repressors off) See Diag. of TXN Complex (attached at END of Packet) = KEY to Step One is the _______________________________________!!! Note: Prokaryotes do NOT use TF’s, RNA Polymerase is placed on it’s own using a TATA Sequence Recognition. Extra Info about Cell Type Specific Transcription Inititation from Pg 302! What if ANOTHER Gene in the SAME CELL uses the SAME THREE Activators? This would be the Eukaryotic Equivalent to Prokaryotic __________________ Step 2: _______________________: RNA Polymerase moves along DNA Template strand (NOTE: Template runs ______________ RNA made ____________) and the DNA helix continues to _________________ as the TXN ___________ moves forward and __________________ after it passes! Refer to the TXN BUBBLE Image Previously in the notes! Step 3: ________________________: Stop Sequence in ________ Template signals for the Release of the RNA Transcript. Prokaryotes and Eukaryotes differ and many unique mechanisms for each. Euk Ex. Polyadenylation signal in Coding Region signals for Enzymes to asseble in Termination Region and Cleave the Transcript from the Polymerase and Template! Still not FULLY Understood to give details! Prok Ex. GC Hairpin – Regardless of Mechanism, the ___________________________ is free and can be Used Again!!!!!! Step 4: __________________________________ of mRNA TRANSCRIPTS: ONLY in EUKARYOTES! See Section 14.3 Pages 276-278 = WHY? FOUR DIFFERENT AREAS of FOCUS: 1st - ALL mRNA Transcripts – Must Occur: (Refer to Comic Book page 146) 1) 2) 2nd – MOST Eukaryotic mRNA Transcripts also undergo: ________________________: (More Detail Pg 300 and Pg 304 in CH15) = A _________________________ assembles and Modifies the _______ mRNA transcript by Excising OUT _______________ and Leaving IN __________________ to make a _______________ mRNA transcript = Memory AID: _______________ INTerfere and _____________ are EXpressed!!!!!!! HOW? DNA Regions: (1) _____________ contain the nucleotide base sequence that holds the codons for building the desired protein EXPRESSED / “Coding Region” (2) _____________ regions of DNA that are still transcribed into mRNA, but are NOT involved in making the protein must be spliced out!!! They INTERFERE and are the “Non-Coding Region” ? How are INTRONS ID’ed??? Answer: By a ___ ___ start sequence and an ___ ___ end sequence that is recognized by a __________________ complex that will cut it out!!!! Diagram of “SPLICING”: 1O mRNA–Exact transcript from DNA! 1O b/c NOT complete yet!!! (AkA-Precursor) GTP Cap POLYA Tail Splicing Occurs: Results in MATURE mRNA: GTP Cap POLY – A Tail MATURE mRNA is now ready to leave the NUCLEUS & attach to a RIBOSOME in the Cytoplasm for translation NOTE: “_____________________ Splicing” can occur to produce different Mature mRNA transcripts from the SAME 1O mRNA transcript. For EXAMPLE: GTP Cap POLYA Tail GTP Cap NOTE: ALTERNATIVE SPLICING Can Occur – This is what Allows 1 CODING Gene to be Transcribed into 1 PremRNA, but then give Rise to ALTERNATE VERSIONS of the Mature mRNA Transcript – Each leading to a DIFFERENT ___________________!!!!! This is why the Human Genome can ONLY have _______________ Coding Genes but over ________________ Proteins! Beadle and Tatum’s 1 Gene = 1 Polypeptide would be MOST ACCURATELY Stated as “1 Coding Gene = 1 ____ mRNA!” * Comic Book Pages 147-149 POLY – A Tail GO to the CH14 Gene Expression / Regulation CH15 Wiki and VIEW the Spliceosome Step by Step Animation and READ ABOUT: EXON SKIPPING DRUGS???? DMD – Duchene’s Muscular Dystrophy!!!! 3rd – mRNA Editing A Enzyme/Protein Complex called _______________ Modifies the 1 0 mRNA transcript by replacing some of the “A” N-Bases with “I” ______________. Chemically, “I” acts as “G” so it changes how a codon is read: AAU becomes AIU which is now Read as AGU Result??? Asn to Ser This Changes the _________________________________!!! Just like the Alternate Mature mRNA’s after Alternative Splicing! Statistic at One Point in Time: 1637 Genes undergo editing w/ 12,732 A to I edits! This is constantly changing, so GOOGLE it for More Info if Interested! They are LINKING many Disorders to Faulty ADAR Activity!!! Abstract from PubMed to support! 4th – RNAi Page 305 and 306! Regulation of a MATURE mRNA Transcript my miRNA (or siRNA) miRNA: siRNA: Simplified Diagram: Plus – See Animations on Wiki! Oncogene – Coding Gene that Leads to CANCER (Codes for Proteins that Speed up Cell Cycle – BK Pg 324 CH16) Tumor Supressor – Coding Gene that Supresses/Stops Uncontrolled Cell Growth/Cancer (Codes for Proteins that either Proofread to Repair Mutations in proto-oncogenes OR Code for Proteins that STOP Cell Cycle at Proper CheckPoints / like Brakes of a car – BK Pg 325 CH16) oncoMIR???? _________________ Gene that codes for a _______________ that can act on the transcript from a ______________________ Gene to STOP it from Functioning and LEAD TO CANCER!!! Note: How a _____________________ gene can now be another Cause of Cancer!! SECTION 14.4: “TRANSLATION” View Video Clip of Translation (BioLiv2ndEd if it still works!) _________ ________________ ? ? NEEDED ? = ______ = Binds w/ Proteins to from the Ribosomes (2 subunits) – Bk pg281 Fig 14.17 = ______ = Hairpin Shape!!! Diag Below = Note: __________________________________ binds the proper a.a. to the correct tRNA. (Bk Pg 280 Fig 14.16) – also called Activating Enzymes for General Name!!! = Start / Stop “Codons” or Signals: ____ ____ ____ ____ * Stop Codons call for a _________________, NOT an a.a. Count as a CODON # in the gene, but not as an a.a. in the chain. = WOBBLE – See Page 280 – Why there are not 61 tRNA’s! 4 STEPS of the Translation Process: STEP 1: ______________________ : Formation of the Initiation Complex. (Bk Pg 282 / Fig 14.18) Diagram of Step 1: NOTE: Initiating Factors/Enzymes assemble the complex – Not Shown in the Diagram! NOTE: The 1st tRNA binds at the “P” site, all others will bind at the “A” site. NOTE: If the “A” site has CCU, What is the next tRNA Anticodon? _________ What will be the next aa? _______ STEP 2: ______________________ : 2nd tRNA reads the codon in the “A” site to bring the next a.a. in the chain : the a.a. in the “P” site and “A” site join by a ____________________________ reaction. Diag: Diagram of Step 2: ___________________ and Step 3: ___________________ Note: This repeats for every New Codon that comes into the “A” site until a STOP Codon is reached!!! Bk Pg 282 and 283 STEP 3: ____________________________! The RIBOSOME will move down ____Nucleotides on the mRNA (1 Codon!) in the __________ direction after EACH elongation. = The EMPTY tRNA is shifted from the “P” site to the “E” site where it is E-jected AND another ____________________________/Activating Enzyme will bind a New a.a. to it for Re-Use! The “A” site is now open for the NEXT Elongation!! STEP 4: _______________________: Codon calls for a Nonsense Codon / STOP!!! A Release Factor comes to the “A” site and signals the release of the Polypeptide Chain along with the Dis-Assembly of the whole Initiation Complex. (Bk Pg 282 and 282 / Fig 14.20) Diagram of Step 4: Step 5: POST Translational Modifications! Go to WIKI to Read Article on POST Translation with Inteins and Exteins! Glycosylation is also a Post-Tranlational Modification that occurs in the GOLGI! NOTE: Before it goes to the GOLGI, it must have come from the ______!!! That means that it was made on a RIBOSOME that HAS to ________________ to the ER!!! HOW? BK Pg 285 Rig 14.21 All Translation starts on a _____________ Ribosome in the ___________and then the newly made polypeptide has a SIGNAL PEPTIDE sequence about 20aa’s long at the ___-Terminus that is recognized by a complex called the __________ (Signal-Recognition Particle). This escorts the ribosome to a receptor on the ER. PROKARYOTIC vs EUKARYOTIC Comparison: What are the Differences and Why???? Page 286: Both Prokaryotes and Eukaryotes: Only Prokaryotes: 14.5: Mutations – Changes in the genetic material Point Mutation – Chemical Changes in just ONE or a FEW Nucleotide Pairs affecting the DNA Template Sequence of the Gene. This CAN Lead to the Production of an Abnormal Protein. Most Recgonized Example: Beta Globin Gene of Hemoglobin! TWO Categories: 1) Nucleotide Pair Substitution – Seen with Hemoglobin (Missense) 2) One or more Nucleotide Pair Insertions or Deletions! See Diagram: Add Definitions on Diag: Eukaryotic Gene Expression is REGULATED at MANY STAGES!!! THIS is an AREA of MAJOR Focus!!!!!!! The DNA Level with Chromatin Modification has opened up the new area of “EPIGENETICS”! Not Picture at the TRANSLATION LEVEL would be the use of miRNA to STOP the TRANSLATION of a polypeptide/protein product!!! WE FINALLY FINISHED!!!! Be sure to FOCUS on ALL of the DIAGRAMS in these CHAPTERS!!! PRACTICE PROBLEM #1: Use Page 273 in Book for Chart!! DNA ______ ____________ 3’ T A C T T A A C C A C T C G C 5’ PRACTICE PROBLEM #2 = Given the a.a., Fill in the Rest 3’ ____ ____ ____ 5’ DNA 5’ ____ ____ ____ 3’ 5’ ____ ____ ____ 3’ mRNA Codon ____ ____ ____ tRNA AntiCodon TRYPTOPHAN (aa in protein) PRACTICE PROBLEM #3 = Practice Splicing 1O mRNA AUGCCGGUAACGGAGCCUAAGUAGCCC STUDY for CH 14/15 Exam (All Note-Sheets, Comic Book, and Book/Figures) PLUS a few ?’s will come from Chapter 13 (Rep Fork Diag & ScientistsContribution to DNA discovery/structure) Comic Book 6 Frame Old Book PG 326 and 327 with Splceosome ID Info