Download HW#2 (first draft)

Biotechnology 2010
Mid-Term Exam
Answer all six questions in the spaces provided: Q1[3], Q2[5], Q3[8], Q4[7], Q5[3], Q6[4] = 30 pts..
Read the questions carefully. Make your answers clear but brief.
1. (i) You use the two primers and template shown below (bold highlights mismatches) in a PCR
reaction. Write down the sequence of BOTH strands (one under the other with 5’ and 3’ clearly
marked) for the first AND last eight bp of the most common PCR product.
[2]
5’GTACTTCAGACTTAAGTCGAG
3’
5’…AGTACTTTAGACTTAAGTCGAGGTCA……………………TAGGCCTAACTGATCGTACCGACGTA..3’
3’…TCATGAAATCTGAATTCAGCTCCAGT……………………ATCCGGATTGACTAGCATGGCTGCAT..5’
3’CCGGATTGACTAGCATGGCTACCT 5’
5’GTACTTCA…………………………….. CCGATGGA 3’
3’CATGAAGT…………………………….. GGCTACCT 5’
(ii) Imagine that the double-stranded DNA template for a PCR reaction has two blocks of sequence of
70bp that are identical (a perfect repeat, indicated by the rectangles below), separated by a stretch of
normal, unique DNA sequence of about 800bp. You use 25nt long primers complementary to
sequences in the repeat in the positions illustrated below. Note that the diagram illustrates where you
designed the primers to hybridize to give a roughly 800bp product and does not necessarily show all
possible hybridization sites.
Would you get a normal, good yield of only the roughly 800bp product? Explain.
[1]
No, primers would also hybridize to same repeat producing a 70nt product, and producing less 800nt
product.
2. When oligonucleotides are synthesized chemically (from 3’ to 5’) they can be made in large
amounts and can have any sequence but there are still limits to what can be made with suitable purity.
(i) Random hexamers (a roughly equimolar mixture of 6nt oligos of every possible sequence) are
sometimes used to prime DNA synthesis. How are random hexamers made?
[1]
Start with mix of beads with A,G, C and T as first nucleotide, then add 25% of each at every step in
synthesis.
(ii) Primers for DNA sequencing are often purified according to their length before use. Consider a
situation where there was no purification according to length after synthesis and where synthesis was
poorer than usual, resulting in only about 50% of the correct product. Would that impure mixture of
oligos be suitable for use as a primer in DNA sequencing? Explain PRECISELY.
[1]
Impurities will have same 3’ end but different lengths. Hence, a ddNTP put in at a specific position
will produce 50% correct length product and up to 50% of a mixture of different lengths (not all
impurities will prime well).
(iii) The efficiency of each coupling step during oligo synthesis is less than 100%, setting a practical
limit on the length of an oligo that can be obtained in good yield and purity.
(a) How can you build double-stranded DNA molecules five (or so) times longer than the longest oligo
you can synthesize?
[1]
Make oligos that are partially complementary so they can anneal together in a pre-determined order. If
this leaves just nicks, seal with DNA ligase. If there are single-stranded gaps fill in with DNA
polymerase and seal with DNA ligase.
(b) If you needed to make much longer double-stranded DNA (hundreds of times longer than one
oligo) you would have to add an extra step to your method above to obtain a good yield of the right
product. What would that be?
[1]
You need to amplify and purify intermediate products either by PCR with end primers or by cloning.
(iv) If you have a mixture of two recombinant circular plasmid DNAs that differ at only one base pair,
how would you BEST purify one from the other?
[1]
Transform into E. coli. Pick single colonies and test content by sequencing key region of DNA.
3.
(i) Even when simply ligating a single linear insert fragment to linear vector DNA with compatible
single-stranded overhangs generated by restriction enzyme cleavage it is hard to produce enough of the
right product for transforming E. coli for you to see and purify from an agarose gel.
Why is it not important to purify the right product before transformation?
[1]
Several single colonies can be screened after transformation for correct product. Reasonable if correct
product is only one in ten or so.
(ii) If you perform a similar ligation with blunt-ended fragments it is even less efficient. Sometimes
you would choose to clone a blunt-ended fragment by first ligating to linkers (short, blunt-ended
double-stranded DNA made from annealing two complementary oligos) and the cutting at a restriction
site within the linkers to generate sticky ends. This can improve the efficiency of the whole cloning
process but how can that be the case since the ligation to linkers is also blunt-ended?
[1]
Linkers are used at very high concentration to drive the ligation reaction.
(iii) Sometimes you need to alter one single-stranded overhang to a different single-stranded overhang
sequence in order to ligate a DNA fragment to a vector. For this you can ligate to an adapter (two
annealed oligos forming different overhangs at each end). How can you ensure that only one adapter
molecule ligates to the end of your DNA fragment?
[1]
Leave adaptor with 5’-OH on each strand.
(iv) If you are ligating a DNA fragment into a lambda phage vector, what do you do after the ligation
to introduce DNA into cells AND see clones containing single recombinant DNAs?
[2]
Add packaging mix, then add to cells & plate on growth medium in soft agar so that plaques can form.
(v) It is possible to join two fragments together without using DNA ligase or any other enzyme.
How, in principle, is this achieved (include at least a rough idea of how suitable DNA molecules for
this are made)?
[2]
Two molecules must share some identical sequence at their ends. This must be made single-stranded
and be long enough to allow specific stable hybridization (followed by transformation of E. coli).
(vi) It is also possible to join two DNA molecules together using a site-specific recombinase instead of
T4 DNA ligase, but the DNA fragment you want to join to a vector must have the DNA sequence
recognized by the recombinase.
How do you most easily add that specific sequence to your DNA fragment?
[1]
Add the sequence to the 5’ end of primers used for PCR amplification of the fragment.
4. Consider conventional cycle DNA sequencing with four ddNTPs labeled with different fluorescent
dyes and using a DNA DNA polymerase which, as usual, has very little 3’ to 5’ exonuclease activity.
(i) What sequence would you READ (start position and direction are important) using the following
template and primers?
(a)
5’
GATCTAGAGGCCTTGAA 3’
3’…….CTAGATCTCCGGAACTTGCTATAGGTC…………
[1]
5’
5’ CGATATCCAG…….
(b)
5’
GATCTAGAGGCCTTGAG 3’
3’…….CTAGATCTCCGGAACTTGCTATAGGTC…………
[1]
5’
bold highlights mismatch above
No sequence (no priming).
(c)
[1]
5’
GATCTAGAGGCCTTGAA 3’
5’ ACTTAGTTAGGCCTCGC
3’
3’…….CTAGATCTCCGGAACTTGCTATAGGT…...TGAATCAATCCGGAGCGGGCATTGA..5’
Two sequences on top of each other, as below
5’ CGATATCCAG…….
5’ CCGTAACT…..
(ii) If you had the sensitivity to detect as little as just one single molecule in conventional sequencing
(which you can’t), roughly how many DNA template molecules would you need to start with as a
minimum to read 800nt of sequence reasonably well? Explain.
[1]
More than 800 products must be made (probably at least about 4,000) because there is a distribution of
stop sites at random. In one round of synthesis that would require one template per product. However,
if there were 20 cycles of sequencing you would need 20 times fewer templates (so perhaps 200).
Considering either the need for excess templates to accommodate distribution of stops or number of
cycles gained full credit (800 worth ½).
(iii)What are the essential steps in whole genome shotgun sequencing (ignore “finishing” [filling in
gaps] steps) using conventional dideoxy sequencing techniques?
[3]
Fragment DNA, modify ends & clone in a vector (plasmid or BAC, usually as size-selected fragments
in three size classes).
Sequence clone inserts from ends (using primers hybridizing to adjacent vector sequence)
Assemble contigs from sequence information by looking for exact sequence overlaps & merging such
sequences.
5. (i) When making a genomic library care is taken to minimize the chance of recovering clones that
include two genomic fragments ligated to each other (because such junctions would be mis-leading).
In principle (no details) what are TWO ways this can be done?
[2]
Phosphatase-treat inserts.
Modify vector & insert ends by fill-ins so that vector can only ligate to insert & vice versa.
Size select fragments before cloning and clones afterwards (if lambda does not do this automatically)
to match.
(ii) When making cDNA libraries with the purpose of collecting representatives of all genes,
sometimes the first strand cDNA made from mRNA is hybridized back to the mRNA population and
cDNA/mRNA hybrids are removed before proceeding further. What does this accomplish (do not just
use a name, but explain)?
[1]
It reduces the abundance of cDNAs over-represented in mRNA relative to other cDNAs
(normalization).
6. Look at the pedigree below showing a family with a disease affecting a father, grandfather and
daughter, together with genotyping results for a single locus A (a DNA marker, not the disease gene)
that is on the same chromosome as the disease gene.
(i) In the father’s DNA (of normal diploid cells, not gametes) is the disease allele (the mutant version
of the relevant gene, which we are assuming acts dominantly here) on the same chromosome as A1 or
A2? Explain.
[1]
Grandfather shows that the disease gene allele could only have been contributed to the father on the
same chromosome as A2.
(ii) Looking at the meiosis in the father that produced gametes contributing to the unaffected son (with
marker genotype A2 A5) can you tell if there was a recombination between the disease gene locus and
the A marker locus? Explain.
[1]
Yes, you know which allele and which marker were in the relevant sperm (& hence that there was
recombination).
(iii) Was there a recombination between the disease gene and marker A in the meiosis contributing to
the affected daughter? Explain.
[1]
Yes. A2 originally together with disease allele but disease allele passed on together with A1 to this
daughter.
(iv) What type of polymorphic marker do you think was examined at locus A?
[1]
An STRP. A has many different alleles (more than four) & therefore cannot be a SNP & must be
highly variable in the population, characteristic only of tandem repeats.