* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetics exam 4
Cancer epigenetics wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Molecular cloning wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA vaccination wikipedia , lookup
X-inactivation wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Human genome wikipedia , lookup
RNA interference wikipedia , lookup
Designer baby wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Frameshift mutation wikipedia , lookup
Gene expression profiling wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
RNA silencing wikipedia , lookup
DNA supercoil wikipedia , lookup
Epigenomics wikipedia , lookup
Neocentromere wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Microevolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Expanded genetic code wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Transfer RNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Helitron (biology) wikipedia , lookup
History of RNA biology wikipedia , lookup
Polyadenylation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
RNA-binding protein wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
BioSc 231 General Genetics Sample Exam 4 Name __________________________________ Multiple Choice. (1 points each) _____ Which of the following is unique to eukaryotic gene expression? A. 5' polyadenylation of mRNA B. Polycistronic mRNA C. Coupled transcription-translation D. Removal of introns E. Polysomes _____ Which of the following statements is true regarding gene expression? A. The 3' end of mRNA corresponds to the carboxyl terminus of the protein B. The first step is the association of mRNA with an intact ribosome C. Involves proof-reading of the mRNA D. Prokaryotic RNA usually undergoes nuclear processing E. Polypeptides are synthesized by addition of amino acids to the amino terminus _____ Which of the following features is common to both DNA replication and transcription? A. Nucleotides are added to the 5' end of the newly synthesized strand B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate C. Deoxyribonucleotides are incorporated into the growing sequence D. Both RNA and DNA polymerase require oligonucleotide priming E. Both RNA and DNA polymerase initiate at promoter sequences _____ Which of the following is unique to prokaryotic gene expression? A. Coupled transcription-translation B. Exon processing C. 3' polyadenylation D. mRNA capping E. Promoter sequences _____ Which of the following is true regarding gene expression? A. Only one gene can be present within a given DNA sequence B. Mistakes in transcription are corrected by RNA polymerase C. The ribosome binding site lies at the 3' end of mRNA D. A change in genotype always results in a changed phenotype E. A second round of transcription can begin before the preceding transcript is completed _____ Which of the following is true regarding RNA processing? A. Spliceosomes are present in organelles and nuclei B. Involves removal of exons C. Involves removal of one or more introns. D. Occurs in prokaryotes E. None of the above _____ Which of the following occurs only in prokaryotes? A. TATA boxes B. Self-terminating transcription C. Polycistronic mRNA D. Coordinate gene regulation _____ To describe the genetic code as degenerate indicates that A. mRNA is rapidly degraded B. The code is not universal among organisms C. Some amino acids have more than one codon D. Frameshift mutations are tolerated E. Stop codons may have corresponding tRNA molecules _____ Normal self-termination of transcription occurs due to the presence of A. stem-loop sequences in mRNA B. Termination proteins C. Multiple RNA polymerase molecules D. Polyribosome formation _____ Which of the following is characteristic of prokaryotic mRNA? A. Polyadenlyation of the 3' end of mRNA B. Rapid turnover of mRNA C. Removal of introns to form mature message D. Formation of lariat structures E. Capping of the 5' mRNA terminus _____ Which of the following is true regarding the machinery of translation? A. Initiation usually begins at an AUG codon B. Eukaryotes have nuclear ribosomes C. Polycistronic mRNA usually has a single ribosome binding site D. tRNAs released from the ribosome are degraded E. Termination is at inverted repeats _____ A biochemical mutant that must be supplied with a particular nutrient for growth A. Conditional B. Lethal C. Auxotroph D. Prototroph E. Autotroph _____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called A. Nucleosomes B. Euchromatin C. Chromatids D. Heterochromatin E. 30 nm chromatin _____ Which histone protein is present as a monomer within the nucleosome and is not a part of the core particle? A. H1 B. H2A C. H2B D. H3 E. H4 _____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNA A. Has a single centromere B. Has telomeres C. Is circular D. Does not undergo supercoiling _____The genes coding for histones are repeated several times throughout the eukaryotic genome. These genes would be described as A. Highly repetitive DNA B. Unique sequences C. Heterochromatin D. Transposons E. Middle repetitive DNA _____ A chromosome with its centromere in the middle is a A. Submetacentric chromosome B. Metacentric chromosome C. Acrocentric chromosome D. Telocentric chromosome Problems (variable points each) (5 pts) Using the table below, determine the amino acid sequence of the polypeptide produced by the following messenger RNA: ACGUAUGGCGACGUUGCGUUUUCGCUGCUGCAUGAACCGAGAUUGACGCUAAGGCAUGAAAA (2 pt) A single base change in the above sequence results in a polypeptide that is only 7 amino acids in length. Which codon is changed and what is the change? Short Answer (2 points each) The site of RNA polymerase binding on the DNA template is called the _______________________. The three nucleotides on a tRNA molecule that pair with the three nucleotides of a specific codon in mRNA are called the _______________________. A single mRNA transcript containing multiple genes is called _______________________. The simultaneous occurrence of mRNA synthesis and protein synthesis in prokaryotes is called _________________________________________. A wild type bacterial strain capable of growth in a defined minimal medium containing only a carbon source and inorganic compounds is called a(n) _______________________. A mutant microorganism unable to synthesize an essential compound but able to grow if that compound is supplied exogenously is called a(n) ____________________________. The diagram to the right depicts the result of an experiment in which a mRNA molecule (thick black line) from a human cell is hybridized to a fragment of DNA that includes the entire gene that produces the mRNA. Briefly explain why these molecules do not line up exactly. Translate the following mRNA (the underlined text is the ribosome binding site) 5’ GAUGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’ Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a prokaryote). A) Promoter -10 and -35 B) AUG C) Ribosome binding site D) Coding sequence E) Transcriptional terminator F) Amino and carboxyl ends of the resulting protein. Short essay (5 points) Describe either the process of transcription or the process of translation. Bonus (4 points) Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells. Include all proteins involved in forming the structure and all intermediate structures.