Download Genetics exam 4

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Cancer epigenetics wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

NEDD9 wikipedia , lookup

Molecular cloning wikipedia , lookup

Site-specific recombinase technology wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

MicroRNA wikipedia , lookup

DNA vaccination wikipedia , lookup

X-inactivation wikipedia , lookup

Epigenetics in learning and memory wikipedia , lookup

Human genome wikipedia , lookup

RNA interference wikipedia , lookup

Designer baby wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Frameshift mutation wikipedia , lookup

Gene expression profiling wikipedia , lookup

Replisome wikipedia , lookup

Short interspersed nuclear elements (SINEs) wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Long non-coding RNA wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Nutriepigenomics wikipedia , lookup

RNA silencing wikipedia , lookup

DNA supercoil wikipedia , lookup

Genomics wikipedia , lookup

Epigenomics wikipedia , lookup

Nucleosome wikipedia , lookup

Neocentromere wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Microevolution wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

Expanded genetic code wikipedia , lookup

Epigenetics of human development wikipedia , lookup

RNA wikipedia , lookup

Transfer RNA wikipedia , lookup

Non-coding DNA wikipedia , lookup

Point mutation wikipedia , lookup

Genetic code wikipedia , lookup

Gene wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Helitron (biology) wikipedia , lookup

History of RNA biology wikipedia , lookup

Polyadenylation wikipedia , lookup

RNA-Seq wikipedia , lookup

Non-coding RNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

RNA-binding protein wikipedia , lookup

Ribosome wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Messenger RNA wikipedia , lookup

Primary transcript wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
BioSc 231
General Genetics
Sample Exam 4
Name __________________________________
Multiple Choice. (1 points each)
_____ Which of the following is unique to eukaryotic gene expression?
A. 5' polyadenylation of mRNA
B. Polycistronic mRNA
C. Coupled transcription-translation
D. Removal of introns
E. Polysomes
_____ Which of the following statements is true regarding gene expression?
A. The 3' end of mRNA corresponds to the carboxyl terminus of the protein
B. The first step is the association of mRNA with an intact ribosome
C. Involves proof-reading of the mRNA
D. Prokaryotic RNA usually undergoes nuclear processing
E. Polypeptides are synthesized by addition of amino acids to the amino terminus
_____ Which of the following features is common to both DNA replication and transcription?
A. Nucleotides are added to the 5' end of the newly synthesized strand
B. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate
C. Deoxyribonucleotides are incorporated into the growing sequence
D. Both RNA and DNA polymerase require oligonucleotide priming
E. Both RNA and DNA polymerase initiate at promoter sequences
_____ Which of the following is unique to prokaryotic gene expression?
A. Coupled transcription-translation
B. Exon processing
C. 3' polyadenylation
D. mRNA capping
E. Promoter sequences
_____ Which of the following is true regarding gene expression?
A. Only one gene can be present within a given DNA sequence
B. Mistakes in transcription are corrected by RNA polymerase
C. The ribosome binding site lies at the 3' end of mRNA
D. A change in genotype always results in a changed phenotype
E. A second round of transcription can begin before the preceding transcript is completed
_____ Which of the following is true regarding RNA processing?
A. Spliceosomes are present in organelles and nuclei
B. Involves removal of exons
C. Involves removal of one or more introns.
D. Occurs in prokaryotes
E. None of the above
_____ Which of the following occurs only in prokaryotes?
A. TATA boxes
B. Self-terminating transcription
C. Polycistronic mRNA
D. Coordinate gene regulation
_____ To describe the genetic code as degenerate indicates that
A. mRNA is rapidly degraded
B. The code is not universal among organisms
C. Some amino acids have more than one codon
D. Frameshift mutations are tolerated
E. Stop codons may have corresponding tRNA molecules
_____ Normal self-termination of transcription occurs due to the presence of
A. stem-loop sequences in mRNA
B. Termination proteins
C. Multiple RNA polymerase molecules
D. Polyribosome formation
_____ Which of the following is characteristic of prokaryotic mRNA?
A. Polyadenlyation of the 3' end of mRNA
B. Rapid turnover of mRNA
C. Removal of introns to form mature message
D. Formation of lariat structures
E. Capping of the 5' mRNA terminus
_____ Which of the following is true regarding the machinery of translation?
A. Initiation usually begins at an AUG codon
B. Eukaryotes have nuclear ribosomes
C. Polycistronic mRNA usually has a single ribosome binding site
D. tRNAs released from the ribosome are degraded
E. Termination is at inverted repeats
_____ A biochemical mutant that must be supplied with a particular nutrient for growth
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called
A. Nucleosomes
B. Euchromatin
C. Chromatids
D. Heterochromatin
E. 30 nm chromatin
_____ Which histone protein is present as a monomer within the nucleosome and is not a part of the core particle?
A. H1
B. H2A
C. H2B
D. H3
E. H4
_____ E. coli genomic DNA differs from a eukaryotic chromosome in that E. coli DNA
A. Has a single centromere
B. Has telomeres
C. Is circular
D. Does not undergo supercoiling
_____The genes coding for histones are repeated several times throughout the eukaryotic genome. These genes would be described as
A. Highly repetitive DNA
B. Unique sequences
C. Heterochromatin
D. Transposons
E. Middle repetitive DNA
_____ A chromosome with its centromere in the middle is a
A. Submetacentric chromosome
B. Metacentric chromosome
C. Acrocentric chromosome
D. Telocentric chromosome
Problems (variable points each)
(5 pts) Using the table below, determine the amino acid sequence of the polypeptide produced by the following messenger RNA:
ACGUAUGGCGACGUUGCGUUUUCGCUGCUGCAUGAACCGAGAUUGACGCUAAGGCAUGAAAA
(2 pt) A single base change in the above sequence results in a polypeptide that is only 7 amino acids in length. Which codon is
changed and what is the change?
Short Answer (2 points each)
The site of RNA polymerase binding on the DNA template is called the _______________________.
The three nucleotides on a tRNA molecule that pair with the three nucleotides of a specific codon in mRNA are called the
_______________________.
A single mRNA transcript containing multiple genes is called _______________________.
The simultaneous occurrence of mRNA synthesis and protein synthesis in prokaryotes is called
_________________________________________.
A wild type bacterial strain capable of growth in a defined minimal medium containing only a carbon source and inorganic
compounds is called a(n) _______________________.
A mutant microorganism unable to synthesize an essential compound but able to grow if that compound is supplied exogenously is
called a(n) ____________________________.
The diagram to the right depicts the result of an experiment in which a mRNA molecule (thick
black line) from a human cell is hybridized to a fragment of DNA that includes the entire gene
that produces the mRNA. Briefly explain why these molecules do not line up exactly.
Translate the following mRNA (the underlined text is the ribosome binding site)
5’ GAUGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU
GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’
Using boxes or lines as a schematic representation of template DNA, mRNA and protein, diagram the parts indicated below (from a
prokaryote).
A) Promoter -10 and -35
B) AUG
C) Ribosome binding site
D) Coding sequence
E) Transcriptional terminator
F) Amino and carboxyl ends of the resulting protein.
Short essay (5 points) Describe either the process of transcription or the process of translation.
Bonus (4 points) Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in
metaphase cells. Include all proteins involved in forming the structure and all intermediate structures.